Transcript: Mouse NR_137634.1

Mus musculus selenoprotein I (Selenoi), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Mus musculus (mouse)
Gene:
Selenoi (28042)
Length:
6672
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_137634.1
NBCI Gene record:
Selenoi (28042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_137634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425111 ATACGTTATGGTCGGTCTTTA pLKO_005 1615 3UTR 100% 13.200 18.480 N Selenoi n/a
2 TRCN0000417046 ATATCACATGTCAGCTAATTG pLKO_005 949 3UTR 100% 13.200 18.480 N Selenoi n/a
3 TRCN0000103320 CGGCTCTTACTGTATCTGATA pLKO.1 1798 3UTR 100% 4.950 6.930 N Selenoi n/a
4 TRCN0000103323 GCTCACATCCATTATGGCGTA pLKO.1 1116 3UTR 100% 2.160 3.024 N Selenoi n/a
5 TRCN0000103321 CCCTAGAATATTCTACTTCAT pLKO.1 908 3UTR 100% 4.950 3.960 N Selenoi n/a
6 TRCN0000103322 GCTCCCAATCTTATAACCTTT pLKO.1 323 3UTR 100% 4.950 3.960 N Selenoi n/a
7 TRCN0000416592 TAACTCCCAGCTTACTCTATT pLKO_005 1394 3UTR 100% 13.200 9.240 N Selenoi n/a
8 TRCN0000103324 TCAATTTCCTACTCCTGACAT pLKO.1 366 3UTR 100% 4.950 3.465 N Selenoi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_137634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12917 pDONR223 100% 8.5% None (many diffs) n/a
2 ccsbBroad304_12917 pLX_304 0% 8.5% V5 (many diffs) n/a
3 TRCN0000472043 GCGCCACTCATTTACGTGGAATCT pLX_317 62.8% 8.5% V5 (many diffs) n/a
Download CSV