Transcript: Human NR_138056.2

Homo sapiens INTS3 and NABP interacting protein (INIP), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
INIP (58493)
Length:
3942
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138056.2
NBCI Gene record:
INIP (58493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136156 GCTGTTTAACTCTCAATCAGA pLKO.1 569 3UTR 100% 3.000 2.100 N INIP n/a
2 TRCN0000343708 GCTGTTTAACTCTCAATCAGA pLKO_005 569 3UTR 100% 3.000 2.100 N INIP n/a
3 TRCN0000136309 GCTACATGAACTGTGACTTTA pLKO.1 395 3UTR 100% 13.200 7.920 N INIP n/a
4 TRCN0000343707 GCTACATGAACTGTGACTTTA pLKO_005 395 3UTR 100% 13.200 7.920 N INIP n/a
5 TRCN0000136778 CTCTGCATTTGGGAACCTTAT pLKO.1 276 3UTR 100% 10.800 6.480 N INIP n/a
6 TRCN0000343706 CTCTGCATTTGGGAACCTTAT pLKO_005 276 3UTR 100% 10.800 6.480 N INIP n/a
7 TRCN0000136221 GAACCAGTCTTCAACAAATCA pLKO.1 202 3UTR 100% 5.625 2.813 Y INIP n/a
8 TRCN0000137389 GCAGAACCAGTCTTCAACAAA pLKO.1 199 3UTR 100% 5.625 2.813 Y INIP n/a
9 TRCN0000135425 GTATCGTCCAAGGAATTGATT pLKO.1 519 3UTR 100% 5.625 2.813 Y INIP n/a
10 TRCN0000343778 GTATCGTCCAAGGAATTGATT pLKO_005 519 3UTR 100% 5.625 2.813 Y INIP n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1168 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000136488 CTAACCAGTCTTAACCATCTT pLKO.1 888 3UTR 100% 4.950 2.475 Y INIP n/a
13 TRCN0000137194 GCAGAACTGGACAAAGAGAAA pLKO.1 164 3UTR 100% 4.950 2.475 Y INIP n/a
14 TRCN0000138611 CTCAAGACTCTGCATTTGGGA pLKO.1 269 3UTR 100% 0.750 0.375 Y INIP n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1091 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1165 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1258 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03862 pDONR223 100% 5.2% None (many diffs) n/a
2 ccsbBroad304_03862 pLX_304 0% 5.2% V5 (many diffs) n/a
3 TRCN0000465608 CTACAAAATTAGTCGAGAGTACAG pLX_317 100% 5.2% V5 (many diffs) n/a
Download CSV