Transcript: Human NR_144350.2

Homo sapiens contactin 2 (CNTN2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CNTN2 (6900)
Length:
7857
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144350.2
NBCI Gene record:
CNTN2 (6900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433342 GTCTGCAGTCACCGGCTATAA pLKO_005 3033 3UTR 100% 13.200 10.560 N CNTN2 n/a
2 TRCN0000414028 TGGCCATGCCCTGGTACAAAT pLKO_005 3141 3UTR 100% 13.200 10.560 N CNTN2 n/a
3 TRCN0000005788 CCGGTCAGATGAAGGCAAATA pLKO.1 1706 3UTR 100% 13.200 9.240 N CNTN2 n/a
4 TRCN0000005787 CGGCAAGAACTGGATAGAAAT pLKO.1 3102 3UTR 100% 13.200 9.240 N CNTN2 n/a
5 TRCN0000005789 GCAGCAGGACATGAATGGTAT pLKO.1 2718 3UTR 100% 4.950 3.465 N CNTN2 n/a
6 TRCN0000005786 GCAGAATTTGTTTGAGGGATA pLKO.1 5780 3UTR 100% 4.050 2.835 N CNTN2 n/a
7 TRCN0000010966 GCTGAGAACTTCATGGGCAAA pLKO.1 1737 3UTR 100% 4.050 2.835 N CNTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07032 pDONR223 100% 38.6% None (many diffs) n/a
2 ccsbBroad304_07032 pLX_304 0% 38.6% V5 (many diffs) n/a
3 TRCN0000471080 GGATTTCCTACCACAATTAACATC pLX_317 6.6% 38.6% V5 (many diffs) n/a
Download CSV