Transcript: Mouse NR_144622.1

Mus musculus polymerase (DNA directed), kappa (Polk), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Polk (27015)
Length:
4061
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144622.1
NBCI Gene record:
Polk (27015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_144622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329098 GAATTTCATTCCCAGTATATA pLKO_005 2738 3UTR 100% 15.000 21.000 N Polk n/a
2 TRCN0000120329 GCTCAATTACAGGTTGACAAA pLKO.1 268 3UTR 100% 4.950 6.930 N Polk n/a
3 TRCN0000329036 GCTCAATTACAGGTTGACAAA pLKO_005 268 3UTR 100% 4.950 6.930 N Polk n/a
4 TRCN0000120331 CCGGAATTTGAACAATACCAT pLKO.1 312 3UTR 100% 3.000 4.200 N Polk n/a
5 TRCN0000329037 CCGGAATTTGAACAATACCAT pLKO_005 312 3UTR 100% 3.000 4.200 N Polk n/a
6 TRCN0000120328 GCCCTTAGAAATGTCTCATAA pLKO.1 1658 3UTR 100% 13.200 10.560 N Polk n/a
7 TRCN0000329097 GCCCTTAGAAATGTCTCATAA pLKO_005 1658 3UTR 100% 13.200 10.560 N Polk n/a
8 TRCN0000329099 ATGTTGGCTACTTCGAATTAC pLKO_005 427 3UTR 100% 13.200 9.240 N Polk n/a
9 TRCN0000120330 GCAAAGAGGAATGTCCTGATA pLKO.1 2146 3UTR 100% 4.950 3.465 N Polk n/a
10 TRCN0000120327 GCACAGTCTTAACCTGACTTT pLKO.1 3744 3UTR 100% 4.950 3.465 N Polk n/a
11 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3498 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11986 pDONR223 100% 29.7% None (many diffs) n/a
2 ccsbBroad304_11986 pLX_304 0% 29.7% V5 (many diffs) n/a
3 TRCN0000471624 TTAGCCATCACTAACGCGATGTAG pLX_317 35.7% 29.7% V5 (many diffs) n/a
Download CSV