Transcript: Human NR_144759.2

Homo sapiens ER lipid raft associated 1 (ERLIN1), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ERLIN1 (10613)
Length:
3293
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144759.2
NBCI Gene record:
ERLIN1 (10613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113314 ACCGAATAGAAGTGGTTAATA pLKO.1 403 3UTR 100% 15.000 21.000 N Erlin1 n/a
2 TRCN0000316161 ACCGAATAGAAGTGGTTAATA pLKO_005 403 3UTR 100% 15.000 21.000 N Erlin1 n/a
3 TRCN0000072457 CCGAATAGAAGTGGTTAATAT pLKO.1 404 3UTR 100% 15.000 21.000 N ERLIN1 n/a
4 TRCN0000290362 CCGAATAGAAGTGGTTAATAT pLKO_005 404 3UTR 100% 15.000 21.000 N ERLIN1 n/a
5 TRCN0000072454 GCGAAAGCAGATGCTGAATAT pLKO.1 981 3UTR 100% 13.200 9.240 N ERLIN1 n/a
6 TRCN0000307188 GCGAAAGCAGATGCTGAATAT pLKO_005 981 3UTR 100% 13.200 9.240 N ERLIN1 n/a
7 TRCN0000072453 GCCCACATAGTGTGGAACAAA pLKO.1 2332 3UTR 100% 5.625 3.938 N ERLIN1 n/a
8 TRCN0000290289 GCCCACATAGTGTGGAACAAA pLKO_005 2332 3UTR 100% 5.625 3.938 N ERLIN1 n/a
9 TRCN0000072456 CGCATTTCTGAAATCGAAGAT pLKO.1 936 3UTR 100% 4.950 3.465 N ERLIN1 n/a
10 TRCN0000290363 CGCATTTCTGAAATCGAAGAT pLKO_005 936 3UTR 100% 4.950 3.465 N ERLIN1 n/a
11 TRCN0000072455 GCAGATTATGACAAGACCTTA pLKO.1 468 3UTR 100% 4.950 3.465 N ERLIN1 n/a
12 TRCN0000290361 GCAGATTATGACAAGACCTTA pLKO_005 468 3UTR 100% 4.950 3.465 N ERLIN1 n/a
13 TRCN0000113311 GCAGAGAAGATTGCACAAGTA pLKO.1 867 3UTR 100% 4.950 2.970 N Erlin1 n/a
14 TRCN0000316164 GCAGAGAAGATTGCACAAGTA pLKO_005 867 3UTR 100% 4.950 2.970 N Erlin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10207 pDONR223 100% 31.5% None 1_143del;792_863del;1254_3293del n/a
2 ccsbBroad304_10207 pLX_304 0% 31.5% V5 1_143del;792_863del;1254_3293del n/a
3 TRCN0000468839 GAATGGCCGCAAAGAAATCGCACG pLX_317 44.3% 31.5% V5 1_143del;792_863del;1254_3293del n/a
Download CSV