Transcript: Human NR_145411.1

Homo sapiens Bardet-Biedl syndrome 9 (BBS9), transcript variant 16, non-coding RNA.

Source:
NCBI, updated 2019-04-16
Taxon:
Homo sapiens (human)
Gene:
BBS9 (27241)
Length:
3864
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145411.1
NBCI Gene record:
BBS9 (27241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160034 CTCGAATTACTGTTCTTGCTT pLKO.1 2036 3UTR 100% 3.000 4.200 N BBS9 n/a
2 TRCN0000161053 GCTCTGCGATAGATTATCCAA pLKO.1 2721 3UTR 100% 3.000 4.200 N BBS9 n/a
3 TRCN0000159543 CATCTGCTAATAGTCACAGAA pLKO.1 3269 3UTR 100% 4.950 3.960 N BBS9 n/a
4 TRCN0000159212 GTAGAACAAGACTCTACAGAA pLKO.1 2924 3UTR 100% 0.495 0.396 N BBS9 n/a
5 TRCN0000166408 CCTCATGCCAAGCACAGATAT pLKO.1 3083 3UTR 100% 13.200 9.240 N BBS9 n/a
6 TRCN0000165680 GCTATTCTGGAAGCGGCATTT pLKO.1 2527 3UTR 100% 10.800 7.560 N BBS9 n/a
7 TRCN0000158544 CCATTAGAATTGACTTGTGAT pLKO.1 1669 3UTR 100% 4.950 3.465 N BBS9 n/a
8 TRCN0000166627 CCCGTACAGATTCCTTCCTTA pLKO.1 842 3UTR 100% 4.950 3.465 N BBS9 n/a
9 TRCN0000159211 GCATGATTTAAAGGGAGTGAT pLKO.1 1293 3UTR 100% 4.950 3.465 N BBS9 n/a
10 TRCN0000162318 CCTGCAATATGACCTATGGAT pLKO.1 683 3UTR 100% 3.000 2.100 N BBS9 n/a
11 TRCN0000166409 CCTTTGGTCATCCATCTGCTA pLKO.1 3257 3UTR 100% 2.640 1.848 N BBS9 n/a
12 TRCN0000162127 CAAAGACACAAGCCAACTGAA pLKO.1 2685 3UTR 100% 4.950 2.970 N BBS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15790 pDONR223 0% 23.7% None (many diffs) n/a
2 ccsbBroad304_15790 pLX_304 0% 23.7% V5 (many diffs) n/a
3 TRCN0000470394 TTGAGGGTCCCGTGCTGCTTATGC pLX_317 55.5% 23.7% V5 (many diffs) n/a
Download CSV