Construct: ORF TRCN0000470394
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017183.1_s317c1
- Derived from:
- ccsbBroadEn_15790
- DNA Barcode:
- TTGAGGGTCCCGTGCTGCTTATGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BBS9 (27241)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470394
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_017011994.2 | 52.2% | 50% | (many diffs) |
| 2 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XR_001744634.2 | 43.6% | (many diffs) | |
| 3 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_005249701.3 | 43% | 41.2% | (many diffs) |
| 4 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_011515270.3 | 41.9% | 40.2% | (many diffs) |
| 5 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348042.2 | 36.3% | 34.9% | (many diffs) |
| 6 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348040.3 | 36.2% | 34.7% | (many diffs) |
| 7 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_014451.3 | 36.1% | 34.7% | (many diffs) |
| 8 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001033604.1 | 35.9% | 34.5% | (many diffs) |
| 9 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001362679.1 | 35.1% | 33.7% | (many diffs) |
| 10 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_011515267.3 | 35.1% | 33.7% | (many diffs) |
| 11 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001033605.1 | 34.7% | 33.3% | (many diffs) |
| 12 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348043.3 | 34.5% | 33.2% | (many diffs) |
| 13 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348036.1 | 34.5% | 33.1% | (many diffs) |
| 14 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_198428.3 | 34.5% | 33.1% | (many diffs) |
| 15 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_011515266.3 | 33.9% | 32.5% | (many diffs) |
| 16 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_017011990.1 | 33.9% | 32.5% | (many diffs) |
| 17 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348041.4 | 33.7% | 32.4% | (many diffs) |
| 18 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_011515265.2 | 33.7% | 32.4% | (many diffs) |
| 19 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348039.2 | 32.2% | 30.7% | (many diffs) |
| 20 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348038.2 | 30.9% | 29.5% | (many diffs) |
| 21 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | XM_011515269.2 | 30.1% | 28.8% | (many diffs) |
| 22 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348037.2 | 29.3% | 27.8% | (many diffs) |
| 23 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348044.2 | 28.4% | 26.9% | (many diffs) |
| 24 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348045.2 | 27.2% | 25.8% | (many diffs) |
| 25 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NM_001348046.2 | 27.2% | 25.8% | (many diffs) |
| 26 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NR_145411.1 | 23.7% | (many diffs) | |
| 27 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NR_145412.1 | 23.1% | (many diffs) | |
| 28 | human | 27241 | BBS9 | Bardet-Biedl syndrome 9 | NR_145413.2 | 22% | (many diffs) | |
| 29 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510421.3 | 59.6% | 60.5% | (many diffs) |
| 30 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | NM_178415.1 | 30% | 30.7% | (many diffs) |
| 31 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | NM_181316.4 | 30% | 30.7% | (many diffs) |
| 32 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510419.3 | 30% | 30.7% | (many diffs) |
| 33 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510415.3 | 29.9% | 30.5% | (many diffs) |
| 34 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510416.3 | 29.9% | 30.5% | (many diffs) |
| 35 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510417.3 | 29.9% | 30.5% | (many diffs) |
| 36 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510418.3 | 29.9% | 30.5% | (many diffs) |
| 37 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_006510420.3 | 27% | 27.4% | (many diffs) |
| 38 | mouse | 319845 | Bbs9 | Bardet-Biedl syndrome 9 (hu... | XM_011242551.2 | 20.1% | 20% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 996
- ORF length:
- 930
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg atacctaagg atctttagcc cccatcctgc aaaaacagga gatggagctc 121 aagccgaaga tttgcttcta gaagtggatc tacgagatcc agtacttcaa gtggaagtag 181 gaaagtttgt ttcaggtacc gaaatgctac atttggctgt gttacattct agaaaacttt 241 gtgtctactc tgtctcagga accttgggta atgtggaaca tgggaaccaa tgtcagatga 301 aattgatgta tgaacataat cttcagagaa cagcctgcaa tatgacctat ggatcatttg 361 gtggtgtaaa aggtcgagat ttaatttgca tccagtctat ggatgggatg ctgatggtat 421 ttgagcagga gagctatgct tttggaagat ttctccctgg ctttcttctg cctggtccTC 481 TTGCCTACAG TTCCCGTACA GATTCCTTCC TTACTGTCTC TTCCTGCCAA CAAGTGGAAA 541 GTTATAAGTA CCAGGTACTT GCTTTTGCAA CAGATGCAGA TAAAAGGCAG GAGACTGAAC 601 AGCAAAAACT TGGTTCTGGA AAAAGACTAG TTGTGGATTG GACTCTAAAT ATTGGAGAGC 661 AAGCCCTTGA CATATGTATT GTCTCTTTCA ATCAGTCGGC ATCCTCTGTT TTTGTTCTTG 721 GTGAGAGAAA CTTTTTTTGC CTTAAGGATA ATGGACAAAT TCGATTCATG AAGAAGCTTG 781 ATTGGAGCCC AAGTTGTTTT CTGCCATATT GCTCAGTTTC TGAAGGAACA ATAAATACTT 841 TGATTGGAAA TCATAATAAC ATGCTGCATA TTTATCAAGA TGTGACACTG AAGTGGGCCA 901 CCCAACTTCC CCACATTCCT GTAGCAGTAA GAGTGGGCTG TTTGCAATTT TCTTTATGGA 961 AGCATTTGTT GCCTCGATCT TCCACTTTAG AAAAATGCCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 ATTGAGGGTC CCGTGCTGCT TATGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt