Transcript: Human NR_145426.1

Homo sapiens RUSC1 antisense RNA 1 (RUSC1-AS1), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RUSC1-AS1 (284618)
Length:
1670
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145426.1
NBCI Gene record:
RUSC1-AS1 (284618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166326 CGCAGAGTTTGTCTGGTGAAT pLKO.1 521 3UTR 100% 4.950 3.960 N RUSC1-AS1 n/a
2 TRCN0000165304 GAGTTTGTCTGGTGAATGCAG pLKO.1 525 3UTR 100% 2.640 1.848 N RUSC1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09967 pDONR223 100% 42.3% None 1_306del;933T>G;1015_1670del n/a
2 ccsbBroad304_09967 pLX_304 0% 42.3% V5 1_306del;933T>G;1015_1670del n/a
3 TRCN0000472888 TGCCCTGTTCAATGTCAATACCTT pLX_317 53.3% 42.3% V5 1_306del;933T>G;1015_1670del n/a
4 ccsbBroadEn_13534 pDONR223 100% 22% None (many diffs) n/a
5 ccsbBroad304_13534 pLX_304 0% 22% V5 (many diffs) n/a
6 TRCN0000491608 TGAATCCGTGCCATCCGGATAATT pLX_317 86.4% 22% V5 (many diffs) n/a
Download CSV