Transcript: Human NR_145451.1

Homo sapiens long intergenic non-protein coding RNA 2012 (LINC02012), long non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
LINC02012 (100129516)
Length:
4400
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145451.1
NBCI Gene record:
LINC02012 (100129516)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12783 pDONR223 100% 4.3% None (many diffs) n/a
2 ccsbBroad304_12783 pLX_304 0% 4.3% V5 (many diffs) n/a
3 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.3% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 3.8% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 3.8% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.8% V5 (many diffs) n/a
Download CSV