Transcript: Human NR_145686.2

Homo sapiens chromodomain helicase DNA binding protein 1 like (CHD1L), transcript variant 28, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CHD1L (9557)
Length:
3077
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145686.2
NBCI Gene record:
CHD1L (9557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013469 GCAGGAAGATTAAATGATGAA pLKO.1 285 3UTR 100% 4.950 6.930 N CHD1L n/a
2 TRCN0000297836 GCAGGAAGATTAAATGATGAA pLKO_005 285 3UTR 100% 4.950 6.930 N CHD1L n/a
3 TRCN0000013472 CGTATTGGACATGCCACGAAA pLKO.1 2654 3UTR 100% 4.950 3.465 N CHD1L n/a
4 TRCN0000280395 CGTATTGGACATGCCACGAAA pLKO_005 2654 3UTR 100% 4.950 3.465 N CHD1L n/a
5 TRCN0000013471 GCCAAGAGAAGGAGACTCATA pLKO.1 2084 3UTR 100% 4.950 3.465 N CHD1L n/a
6 TRCN0000280441 GCCAAGAGAAGGAGACTCATA pLKO_005 2084 3UTR 100% 4.950 3.465 N CHD1L n/a
7 TRCN0000013468 CCTGTCTTTAGCAACCAGCTA pLKO.1 2845 3UTR 100% 2.640 1.848 N CHD1L n/a
8 TRCN0000297839 CCTGTCTTTAGCAACCAGCTA pLKO_005 2845 3UTR 100% 2.640 1.848 N CHD1L n/a
9 TRCN0000013470 GCACAAACTCTTGCAGCCATT pLKO.1 770 3UTR 100% 4.050 2.430 N CHD1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145686.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11389 pDONR223 100% 63.5% None (many diffs) n/a
2 ccsbBroad304_11389 pLX_304 0% 63.5% V5 (many diffs) n/a
3 TRCN0000479276 GCTGATGTGCAGGCAAGTTCTTGA pLX_317 18% 63.5% V5 (many diffs) n/a
Download CSV