Transcript: Human NR_145974.1

Homo sapiens KDM5C adjacent transcript (KANTR), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2018-12-01
Taxon:
Homo sapiens (human)
Gene:
KANTR (102723508)
Length:
6426
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145974.1
NBCI Gene record:
KANTR (102723508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 883 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
2 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 2550 3UTR 100% 4.950 2.475 Y DENND6A n/a
3 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 2851 3UTR 100% 4.950 2.475 Y CCDC30 n/a
4 TRCN0000136988 CCTCCAAGAAATATGGGACTA pLKO.1 4884 3UTR 100% 4.050 2.025 Y LOC440258 n/a
5 TRCN0000137331 GCAGGATATTATCCAGGAGAA pLKO.1 4983 3UTR 100% 4.050 2.025 Y LOC440258 n/a
6 TRCN0000145364 GCACTAAACATGGAAAGGAAA pLKO.1 5385 3UTR 100% 4.950 2.475 Y FLJ44796 n/a
7 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 826 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 3.3% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 3.3% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 3.3% V5 (many diffs) n/a
Download CSV