Transcript: Human NR_146059.2

Homo sapiens glutamate metabotropic receptor 2 (GRM2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GRM2 (2912)
Length:
1932
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146059.2
NBCI Gene record:
GRM2 (2912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009012 CTGCACGCTTTATGCCTTCAA pLKO.1 1035 3UTR 100% 4.950 6.930 N GRM2 n/a
2 TRCN0000378254 ACCGCTTTGGTGATGGTATTG pLKO_005 143 3UTR 100% 10.800 8.640 N GRM2 n/a
3 TRCN0000009011 CTACTGCATGACCTTCATCTT pLKO.1 660 3UTR 100% 4.950 3.465 N GRM2 n/a
4 TRCN0000009014 CCATCTTCTATGTCACCTCCA pLKO.1 1145 3UTR 100% 2.160 1.512 N GRM2 n/a
5 TRCN0000378264 GCTGGAGCACTGCAATAATTT pLKO_005 1510 3UTR 100% 15.000 9.000 N GRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488984 GCTCTGCAATATGTCCCCTAACAA pLX_317 12.1% 45.1% V5 (many diffs) n/a
2 TRCN0000489033 AAACGATTACCACGTACTCTGTGC pLX_317 14.8% 45.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488215 GGACTACGACGTGACCTAGTCAAG pLX_317 12.2% 45% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV