Transcript: Human NR_146089.1

Homo sapiens trafficking kinesin protein 1 (TRAK1), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
TRAK1 (22906)
Length:
5236
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146089.1
NBCI Gene record:
TRAK1 (22906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036275 CCAGATGACTAAGACATATAA pLKO.1 419 3UTR 100% 15.000 21.000 N TRAK1 n/a
2 TRCN0000286856 CCAGATGACTAAGACATATAA pLKO_005 419 3UTR 100% 15.000 21.000 N TRAK1 n/a
3 TRCN0000036276 GCTATCGCAAATAGTTGATTT pLKO.1 971 3UTR 100% 13.200 9.240 N TRAK1 n/a
4 TRCN0000286855 GCTATCGCAAATAGTTGATTT pLKO_005 971 3UTR 100% 13.200 9.240 N TRAK1 n/a
5 TRCN0000294179 TGTACTGCCTTAACGACTTTG pLKO_005 1975 3UTR 100% 10.800 7.560 N TRAK1 n/a
6 TRCN0000421920 TGTACTGCCTTAACGACTTTG pLKO_005 1975 3UTR 100% 10.800 7.560 N Trak1 n/a
7 TRCN0000036278 CAGTCCAGAATTACTTTCATT pLKO.1 718 3UTR 100% 5.625 3.938 N TRAK1 n/a
8 TRCN0000036277 CGACAACAAGACCAACAGCAT pLKO.1 1487 3UTR 100% 2.640 1.848 N TRAK1 n/a
9 TRCN0000286901 CGACAACAAGACCAACAGCAT pLKO_005 1487 3UTR 100% 2.640 1.848 N TRAK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11645 pDONR223 100% 37.4% None (many diffs) n/a
2 ccsbBroad304_11645 pLX_304 0% 37.4% V5 (many diffs) n/a
3 TRCN0000479369 CTTCTCATCTAATATCCCAATAAC pLX_317 7.7% 37.4% V5 (many diffs) n/a
Download CSV