Transcript: Human NR_146184.1

Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2018-04-16
Taxon:
Homo sapiens (human)
Gene:
KYAT3 (56267)
Length:
2031
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146184.1
NBCI Gene record:
KYAT3 (56267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150970 CAAAGATTGCAGCAATCGATA pLKO.1 634 3UTR 100% 4.950 6.930 N KYAT3 n/a
2 TRCN0000151085 GTTTGAGAAGTTTGTGCGTTT pLKO.1 1525 3UTR 100% 4.050 5.670 N KYAT3 n/a
3 TRCN0000120415 GAGCCTTATGACTATAAGTTT pLKO.1 1427 3UTR 100% 0.563 0.788 N Kyat3 n/a
4 TRCN0000320077 GAGCCTTATGACTATAAGTTT pLKO_005 1427 3UTR 100% 0.563 0.788 N Kyat3 n/a
5 TRCN0000152160 CCTCAAGAACTGGAAAGTAAA pLKO.1 966 3UTR 100% 13.200 9.240 N KYAT3 n/a
6 TRCN0000152183 CCTGAGATCTAAACCTGTTTA pLKO.1 908 3UTR 100% 13.200 9.240 N KYAT3 n/a
7 TRCN0000155189 GCATGGATGACCCAGAATGTT pLKO.1 1248 3UTR 100% 5.625 3.938 N KYAT3 n/a
8 TRCN0000152839 GCTCTGTCCTATCTGTATGAA pLKO.1 702 3UTR 100% 5.625 3.938 N KYAT3 n/a
9 TRCN0000151086 GAGATGTTTAACCTCTCAGTA pLKO.1 1878 3UTR 100% 4.950 3.465 N KYAT3 n/a
10 TRCN0000151327 GTCAGCATAACATAGTGGATA pLKO.1 1849 3UTR 100% 4.950 3.465 N KYAT3 n/a
11 TRCN0000155218 GCAGCAATCGATAGCCTGAAT pLKO.1 642 3UTR 100% 4.950 2.970 N KYAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489544 CCGGAACAGGCACACAGATTTTTA pLX_317 19.5% 57.6% V5 (not translated due to prior stop codon) 1_377del;1041_1042ins121;1619_2031del n/a
2 ccsbBroadEn_12300 pDONR223 100% 34.8% None 1_869del;1041_1042ins121;1619_2031del n/a
3 ccsbBroad304_12300 pLX_304 0% 34.8% V5 1_869del;1041_1042ins121;1619_2031del n/a
4 TRCN0000467583 TTTAGCTTGTCCCACATATTATTA pLX_317 44% 34.8% V5 1_869del;1041_1042ins121;1619_2031del n/a
Download CSV