Transcript: Human NR_146185.1

Homo sapiens kynurenine aminotransferase 3 (KYAT3), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2018-04-16
Taxon:
Homo sapiens (human)
Gene:
KYAT3 (56267)
Length:
1745
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146185.1
NBCI Gene record:
KYAT3 (56267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150970 CAAAGATTGCAGCAATCGATA pLKO.1 322 3UTR 100% 4.950 6.930 N KYAT3 n/a
2 TRCN0000151085 GTTTGAGAAGTTTGTGCGTTT pLKO.1 1370 3UTR 100% 4.050 5.670 N KYAT3 n/a
3 TRCN0000120415 GAGCCTTATGACTATAAGTTT pLKO.1 1272 3UTR 100% 0.563 0.788 N Kyat3 n/a
4 TRCN0000320077 GAGCCTTATGACTATAAGTTT pLKO_005 1272 3UTR 100% 0.563 0.788 N Kyat3 n/a
5 TRCN0000152160 CCTCAAGAACTGGAAAGTAAA pLKO.1 811 3UTR 100% 13.200 9.240 N KYAT3 n/a
6 TRCN0000152183 CCTGAGATCTAAACCTGTTTA pLKO.1 753 3UTR 100% 13.200 9.240 N KYAT3 n/a
7 TRCN0000155189 GCATGGATGACCCAGAATGTT pLKO.1 1093 3UTR 100% 5.625 3.938 N KYAT3 n/a
8 TRCN0000152839 GCTCTGTCCTATCTGTATGAA pLKO.1 390 3UTR 100% 5.625 3.938 N KYAT3 n/a
9 TRCN0000155218 GCAGCAATCGATAGCCTGAAT pLKO.1 330 3UTR 100% 4.950 2.970 N KYAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146185.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489544 CCGGAACAGGCACACAGATTTTTA pLX_317 19.5% 63.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_12300 pDONR223 100% 40.1% None 1_714del;886_887ins121;1464_1745del n/a
3 ccsbBroad304_12300 pLX_304 0% 40.1% V5 1_714del;886_887ins121;1464_1745del n/a
4 TRCN0000467583 TTTAGCTTGTCCCACATATTATTA pLX_317 44% 40.1% V5 1_714del;886_887ins121;1464_1745del n/a
Download CSV