Transcript: Human NR_146187.1

Homo sapiens chromosome 8 open reading frame 34 (C8orf34), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
C8orf34 (116328)
Length:
3008
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146187.1
NBCI Gene record:
C8orf34 (116328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421435 TGATAAACCTTGGCAATTAAA pLKO_005 1150 3UTR 100% 15.000 21.000 N C8orf34 n/a
2 TRCN0000417275 GAATTGCTGGAGGATCTTAAT pLKO_005 1694 3UTR 100% 13.200 18.480 N C8orf34 n/a
3 TRCN0000147468 CAAAGGAACAAGAAGGGATTT pLKO.1 1120 3UTR 100% 10.800 7.560 N C8orf34 n/a
4 TRCN0000432798 GAAGTTGCAAGTGGTCCTTAA pLKO_005 2227 3UTR 100% 10.800 7.560 N C8orf34 n/a
5 TRCN0000148404 CCACTGCTCTTTCTCATGATT pLKO.1 2738 3UTR 100% 5.625 3.938 N C8orf34 n/a
6 TRCN0000148947 CCCATTTCTCATTGACCATCT pLKO.1 1012 3UTR 100% 4.050 2.835 N C8orf34 n/a
7 TRCN0000127702 GAGAACACTAATCCTGGCAAA pLKO.1 2386 3UTR 100% 4.050 2.835 N C8orf34 n/a
8 TRCN0000148600 CCCAGATTCATTCGATTCCTT pLKO.1 1912 3UTR 100% 3.000 2.100 N C8orf34 n/a
9 TRCN0000149039 GCTGATCTTCTTCTTTGCGTT pLKO.1 2153 3UTR 100% 2.640 1.848 N C8orf34 n/a
10 TRCN0000129775 CCATTTCTCATTGACCATCTT pLKO.1 1013 3UTR 100% 4.950 2.970 N C8orf34 n/a
11 TRCN0000256054 AGCCAACAAGCACCAGATTAA pLKO_005 251 3UTR 100% 13.200 6.600 Y RPL23AP42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13059 pDONR223 100% 41% None (many diffs) n/a
2 ccsbBroad304_13059 pLX_304 0% 41% V5 (many diffs) n/a
3 TRCN0000476227 CCTAAGGTCATGCATCTGCGGTTA pLX_317 29.8% 41% V5 (many diffs) n/a
Download CSV