Transcript: Mouse NR_146211.1

Mus musculus small nucleolar RNA host gene 14 (Snhg14), long non-coding RNA.

Source:
NCBI, updated 2017-04-12
Taxon:
Mus musculus (mouse)
Gene:
Snhg14 (52480)
Length:
24206
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146211.1
NBCI Gene record:
Snhg14 (52480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_146211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414348 AGACACCAAGAGGTGGTTAAA pLKO_005 1127 3UTR 100% 13.200 6.600 Y SNURF n/a
2 TRCN0000430814 TGCTGCAGCACATTGACTATA pLKO_005 1358 3UTR 100% 13.200 6.600 Y SNRPN n/a
3 TRCN0000431217 TTAGTGTTGACAACGGCTATT pLKO_005 1298 3UTR 100% 10.800 5.400 Y Snurf n/a
4 TRCN0000109286 CAGGAAGATCAAGCCAAAGAA pLKO.1 1476 3UTR 100% 5.625 2.813 Y Snrpn n/a
5 TRCN0000111933 CAACCAAGAGTGTCACTTGTA pLKO.1 1032 3UTR 100% 4.950 2.475 Y Snurf n/a
6 TRCN0000075134 CCTCTGTGATTGTGATGAGTT pLKO.1 1455 3UTR 100% 4.950 2.475 Y SNRPN n/a
7 TRCN0000111931 CGTTCTCAGCAACAGCAAGTT pLKO.1 1060 3UTR 100% 4.950 2.475 Y Snurf n/a
8 TRCN0000111930 GCAACTTCAAGGTGGTGGAAT pLKO.1 1156 3UTR 100% 4.950 2.475 Y Snurf n/a
9 TRCN0000111934 TGAGACACCAAGAGGTGGTTA pLKO.1 1125 3UTR 100% 4.950 2.475 Y Snurf n/a
10 TRCN0000109285 CCTCCTAAAGATACTGGCATT pLKO.1 1588 3UTR 100% 4.050 2.025 Y Snrpn n/a
11 TRCN0000109288 GTTCAGGAAGATCAAGCCAAA pLKO.1 1473 3UTR 100% 4.050 2.025 Y Snrpn n/a
12 TRCN0000421269 TACACTTGAGAAGAACTACTG pLKO_005 953 3UTR 100% 4.050 2.025 Y Snurf n/a
13 TRCN0000425884 AGGTCGAGGTCCAGGTCAAAC pLKO_005 989 3UTR 100% 3.600 1.800 Y Snurf n/a
14 TRCN0000088140 GCTATGAACATAGTGGAGCAT pLKO.1 4548 3UTR 100% 2.640 1.320 Y LOC433577 n/a
15 TRCN0000109287 CCTGCAAGATGGGAGAATCTT pLKO.1 1392 3UTR 100% 0.563 0.281 Y Snrpn n/a
16 TRCN0000111932 GAACTAAGACAGGCATTCTTA pLKO.1 1102 3UTR 100% 0.563 0.281 Y Snurf n/a
17 TRCN0000109289 GCAAGATGGGAGAATCTTCAT pLKO.1 1395 3UTR 100% 0.495 0.248 Y Snrpn n/a
18 TRCN0000075135 GAATCTTCATTGGCACCTTTA pLKO.1 1406 3UTR 100% 10.800 5.400 Y SNRPN n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2672 3UTR 100% 4.950 2.475 Y KAAG1 n/a
20 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 2682 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01575 pDONR223 100% 2.7% None (many diffs) n/a
2 ccsbBroad304_01575 pLX_304 0% 2.7% V5 (many diffs) n/a
3 TRCN0000471606 ATAAAGGACCTTCCAAGGTTCAAG pLX_317 64.7% 2.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV