Transcript: Human NR_147130.1

Homo sapiens Down syndrome critical region 4 (DSCR4), long non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
DSCR4 (10281)
Length:
1114
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147130.1
NBCI Gene record:
DSCR4 (10281)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430580 GCTGAGTAGGTCCACAAATAA pLKO_005 763 3UTR 100% 15.000 21.000 N DSCR4 n/a
2 TRCN0000412474 TAAAGTCTGCAACATCGTTTC pLKO_005 252 3UTR 100% 6.000 4.200 N DSCR4 n/a
3 TRCN0000433208 GATAAGCGCAAGCCCATCAAC pLKO_005 438 3UTR 100% 4.950 3.465 N DSCR4 n/a
4 TRCN0000148160 GTCTGATTCTTGTGTCTACTT pLKO.1 529 3UTR 100% 4.950 3.465 N DSCR4 n/a
5 TRCN0000131182 GCTCCACAAGAAATCAGATGG pLKO.1 402 3UTR 100% 4.050 2.835 N DSCR4 n/a
6 TRCN0000149590 CCTAAAGTCTGCAACATCGTT pLKO.1 250 3UTR 100% 3.000 2.100 N DSCR4 n/a
7 TRCN0000426074 AGTGGGAAAGAAAGAGCTTTA pLKO_005 566 3UTR 100% 10.800 6.480 N DSCR4 n/a
8 TRCN0000130683 CACAAGAAATCAGATGGGAGA pLKO.1 406 3UTR 100% 2.160 1.296 N DSCR4 n/a
9 TRCN0000131226 GAAATCAGATGGGAGAAGGGA pLKO.1 411 3UTR 100% 0.750 0.450 N DSCR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02382 pDONR223 100% 31.7% None 1_105del;460_1114del n/a
2 ccsbBroad304_02382 pLX_304 0% 31.7% V5 1_105del;460_1114del n/a
3 TRCN0000473482 CGAGACTATTGACCTATTAATTAC pLX_317 100% 31.7% V5 1_105del;460_1114del n/a
Download CSV