Transcript: Human NR_147947.2

Homo sapiens ribosomal modification protein rimK like family member B (RIMKLB), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RIMKLB (57494)
Length:
1760
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147947.2
NBCI Gene record:
RIMKLB (57494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140577 GCGGATCAATGGAGAGCTAAT pLKO.1 539 3UTR 100% 10.800 15.120 N RIMKLB n/a
2 TRCN0000144733 GCTGATCTAAGCCATCTTATT pLKO.1 891 3UTR 100% 13.200 10.560 N RIMKLB n/a
3 TRCN0000144365 CCCAATAATGCAGCTGTATAA pLKO.1 1342 3UTR 100% 13.200 9.240 N RIMKLB n/a
4 TRCN0000144937 GAAGAGATAGAGCATGACATA pLKO.1 1495 3UTR 100% 4.950 3.465 N RIMKLB n/a
5 TRCN0000140009 GCTGACAATCGAGCAAGGAAA pLKO.1 509 3UTR 100% 4.950 3.465 N RIMKLB n/a
6 TRCN0000144832 GCAGCTGTATAATGAATGGTA pLKO.1 1351 3UTR 100% 3.000 2.100 N RIMKLB n/a
7 TRCN0000139503 CTGAAGTTCTGGAGTTCCCAA pLKO.1 802 3UTR 100% 2.640 1.848 N RIMKLB n/a
8 TRCN0000140297 GATGAAAGATGACGGCTCCTT pLKO.1 1157 3UTR 100% 2.640 1.848 N RIMKLB n/a
9 TRCN0000140736 GCTCATTGAGTGAACAAGGGA pLKO.1 1075 3UTR 100% 0.750 0.525 N RIMKLB n/a
10 TRCN0000121702 CAGGACTAAGATTCCTGCATT pLKO.1 1547 3UTR 100% 0.495 0.347 N RIMKLB n/a
11 TRCN0000122756 CGGTTAATGAACCGACCTCAA pLKO.1 660 3UTR 100% 0.405 0.284 N RIMKLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12352 pDONR223 100% 52.2% None 1_359del;1151T>C;1281_1760del n/a
2 ccsbBroad304_12352 pLX_304 0% 52.2% V5 1_359del;1151T>C;1281_1760del n/a
3 TRCN0000472196 TGGTCCTCCGCTTATAAGAGGATC pLX_317 57.9% 52.2% V5 1_359del;1151T>C;1281_1760del n/a
Download CSV