Transcript: Human NR_148020.2

Homo sapiens holocarboxylase synthetase (HLCS), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
HLCS (3141)
Length:
8326
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148020.2
NBCI Gene record:
HLCS (3141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045783 CCGCAGGAAATGGGCTTAATA pLKO.1 1768 3UTR 100% 15.000 21.000 N HLCS n/a
2 TRCN0000233104 TGAAGTGGCCCAACGATATTT pLKO_005 1997 3UTR 100% 15.000 21.000 N HLCS n/a
3 TRCN0000233105 CATTGAGTATCGACCGTATTT pLKO_005 5112 3UTR 100% 13.200 18.480 N HLCS n/a
4 TRCN0000045786 CCTACGTGTCTGAAGTAGAAA pLKO.1 1574 3UTR 100% 5.625 7.875 N HLCS n/a
5 TRCN0000233101 CAGACCTTCCCTACGATTATA pLKO_005 686 3UTR 100% 15.000 12.000 N HLCS n/a
6 TRCN0000233103 AGTATCAGGATATCAACTTAC pLKO_005 1973 3UTR 100% 10.800 7.560 N HLCS n/a
7 TRCN0000045787 GCCTGAACCTTCTCTTGAGAT pLKO.1 432 3UTR 100% 4.950 3.465 N HLCS n/a
8 TRCN0000045785 GCTGTGGATTTAATGTGACTA pLKO.1 2321 3UTR 100% 4.950 3.465 N HLCS n/a
9 TRCN0000045784 CCTACGATTATAGCAGCAGTT pLKO.1 695 3UTR 100% 4.050 2.835 N HLCS n/a
10 TRCN0000233102 TACCTCCCAGCTCCAACATAG pLKO_005 1310 3UTR 100% 0.000 0.000 N HLCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06380 pDONR223 100% 26.1% None (many diffs) n/a
2 ccsbBroad304_06380 pLX_304 0% 26.1% V5 (many diffs) n/a
3 TRCN0000481180 TCCAGTAACTAACAAGCTTGTCTG pLX_317 20.9% 26.1% V5 (many diffs) n/a
Download CSV