Transcript: Human NR_148056.2

Homo sapiens zinc finger protein 385B (ZNF385B), transcript variant 18, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF385B (151126)
Length:
3384
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148056.2
NBCI Gene record:
ZNF385B (151126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116204 GCGGTTATTAACCATACATTT pLKO.1 1126 3UTR 100% 13.200 18.480 N ZNF385B n/a
2 TRCN0000116203 CCCGAGTATTCTAGCAGCAAA pLKO.1 1882 3UTR 100% 4.950 6.930 N ZNF385B n/a
3 TRCN0000116205 GCTGGTCCAATTAAATCCTAT pLKO.1 1666 3UTR 100% 4.950 6.930 N ZNF385B n/a
4 TRCN0000116206 GCCCACTACAAAGGAAGTAAA pLKO.1 1231 3UTR 100% 13.200 9.240 N ZNF385B n/a
5 TRCN0000116202 CCAGAGAGAAACACATCACTA pLKO.1 2255 3UTR 100% 4.950 2.970 N ZNF385B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09677 pDONR223 100% 32.2% None (many diffs) n/a
2 ccsbBroad304_09677 pLX_304 0% 32.2% V5 (many diffs) n/a
3 TRCN0000470628 CATTGACGATGAAGAGCCGTGGAA pLX_317 40.3% 32.2% V5 (many diffs) n/a
Download CSV