Transcript: Human NR_149091.1

Homo sapiens XPA, DNA damage recognition and repair factor (XPA), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
XPA (7507)
Length:
1197
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149091.1
NBCI Gene record:
XPA (7507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_149091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358686 TGGTAGGTCAGCTACAAATTT pLKO_005 938 3UTR 100% 15.000 10.500 N XPA n/a
2 TRCN0000358685 ACCAAGGCAAACCCTAGATTG pLKO_005 970 3UTR 100% 10.800 7.560 N XPA n/a
3 TRCN0000083196 CATGAGTATGGACCAGAAGAA pLKO.1 575 3UTR 100% 4.950 3.465 N XPA n/a
4 TRCN0000083193 GCACAATGTCATGTCTGTGAT pLKO.1 867 3UTR 100% 4.950 3.465 N XPA n/a
5 TRCN0000083194 GCATTAGAAGAAGCAAAGGAA pLKO.1 440 3UTR 100% 3.000 2.100 N XPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01783 pDONR223 100% 37.2% None 1_117del;397_398ins272;665_1197del n/a
2 ccsbBroad304_01783 pLX_304 0% 37.2% V5 1_117del;397_398ins272;665_1197del n/a
3 TRCN0000479023 CTTGATAATCGTGAGACTTATGAC pLX_317 63.7% 37.2% V5 1_117del;397_398ins272;665_1197del n/a
Download CSV