Transcript: Human NR_155754.2

Homo sapiens centromere protein C (CENPC), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CENPC (1060)
Length:
6941
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_155754.2
NBCI Gene record:
CENPC (1060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_155754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245069 CATCAGGAGGATTCGTGATTA pLKO_005 2433 3UTR 100% 13.200 18.480 N CENPC n/a
2 TRCN0000150037 CCAGACACAATATCGTCTAAA pLKO.1 2468 3UTR 100% 13.200 18.480 N CENPC n/a
3 TRCN0000148503 CCCGATGATACGAAGTTGATA pLKO.1 1025 3UTR 100% 5.625 7.875 N CENPC n/a
4 TRCN0000148798 CGTGACATTAACACAGAGCAA pLKO.1 218 3UTR 100% 2.640 3.696 N CENPC n/a
5 TRCN0000245067 CATATTACCCAAGACGAATTT pLKO_005 1490 3UTR 100% 13.200 10.560 N CENPC n/a
6 TRCN0000146466 CGTTCTATGTTCCTTCAGGTA pLKO.1 3010 3UTR 100% 2.640 2.112 N CENPC n/a
7 TRCN0000245070 CAGTTTGTATAGTTGGAATAT pLKO_005 3149 3UTR 100% 13.200 9.240 N CENPC n/a
8 TRCN0000245068 TGGACCTTCCAGGCTCAATAA pLKO_005 2200 3UTR 100% 13.200 9.240 N CENPC n/a
9 TRCN0000149570 GCATGGTGAGTTGAAGGTATA pLKO.1 2822 3UTR 100% 10.800 7.560 N CENPC n/a
10 TRCN0000245066 TTCGTGTCCTCCCGATGATAC pLKO_005 1015 3UTR 100% 10.800 7.560 N CENPC n/a
11 TRCN0000146263 CCCAAGACGAATTTCAAAGAA pLKO.1 1497 3UTR 100% 5.625 3.938 N CENPC n/a
12 TRCN0000146581 CGAAGTTGATAGAGGATGAAT pLKO.1 1035 3UTR 100% 5.625 3.938 N CENPC n/a
13 TRCN0000149366 GACCAAGAGAACACGTTTGAA pLKO.1 2365 3UTR 100% 5.625 3.938 N CENPC n/a
14 TRCN0000148134 GAGTCCAAGAACAAACTTGTA pLKO.1 1655 3UTR 100% 4.950 3.465 N CENPC n/a
15 TRCN0000147943 GATACGAAGTTGATAGAGGAT pLKO.1 1031 3UTR 100% 2.640 1.848 N CENPC n/a
16 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 5369 3UTR 100% 1.080 0.540 Y GPR83 n/a
17 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 5369 3UTR 100% 1.080 0.540 Y MYORG n/a
18 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 6242 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_155754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10731 pDONR223 100% 23.3% None (many diffs) n/a
2 ccsbBroad304_10731 pLX_304 0% 23.3% V5 (many diffs) n/a
3 TRCN0000470764 GACTGTAATTTTACTCACTGTCGA pLX_317 21.4% 23.3% V5 (many diffs) n/a
Download CSV