Transcript: Human NR_156695.2

Homo sapiens transmembrane protein 120A (TMEM120A), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TMEM120A (83862)
Length:
1333
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_156695.2
NBCI Gene record:
TMEM120A (83862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_156695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131162 GCAGGCTAAGTTTGCCTACAA pLKO.1 394 3UTR 100% 4.950 6.930 N TMEM120A n/a
2 TRCN0000350664 GCAGGCTAAGTTTGCCTACAA pLKO_005 394 3UTR 100% 4.950 6.930 N TMEM120A n/a
3 TRCN0000149909 GCAGTTTCTCCAGTACTACTA pLKO.1 724 3UTR 100% 4.950 6.930 N TMEM120A n/a
4 TRCN0000128352 CTGACCAAACTTCAGAACAAT pLKO.1 143 3UTR 100% 5.625 3.938 N TMEM120A n/a
5 TRCN0000322557 CTGACCAAACTTCAGAACAAT pLKO_005 143 3UTR 100% 5.625 3.938 N TMEM120A n/a
6 TRCN0000322558 GGGCCCAGTGCCCTCAATAAA pLKO_005 1143 3UTR 100% 5.000 3.500 N TMEM120A n/a
7 TRCN0000127988 GCTGACCAAACTTCAGAACAA pLKO.1 142 3UTR 100% 4.950 3.465 N TMEM120A n/a
8 TRCN0000129289 CCCTGAAGAAATGCAAACCCT pLKO.1 216 3UTR 100% 0.750 0.525 N TMEM120A n/a
9 TRCN0000322630 CCCTGAAGAAATGCAAACCCT pLKO_005 216 3UTR 100% 0.750 0.525 N TMEM120A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_156695.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09122 pDONR223 100% 68.8% None (many diffs) n/a
2 ccsbBroad304_09122 pLX_304 0% 68.8% V5 (many diffs) n/a
3 TRCN0000474407 AATTGTGTGCGAAAGCTCACAGAT pLX_317 47.2% 68.8% V5 (many diffs) n/a
4 ccsbBroadEn_12759 pDONR223 100% 58.4% None (many diffs) n/a
5 ccsbBroad304_12759 pLX_304 0% 58.4% V5 (many diffs) n/a
6 TRCN0000468285 TTTCAATACCGGGGCCGAACGTCG pLX_317 36.6% 58.4% V5 (many diffs) n/a
Download CSV