Transcript: Human NR_157196.2

Homo sapiens dipeptidyl peptidase like 6 (DPP6), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DPP6 (1804)
Length:
4557
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_157196.2
NBCI Gene record:
DPP6 (1804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_157196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046657 CATGTCAAGAAGGCCATAAAT pLKO.1 1895 3UTR 100% 15.000 21.000 N DPP6 n/a
2 TRCN0000046654 CCGGACGAAAGCCATTACTTT pLKO.1 2612 3UTR 100% 5.625 7.875 N DPP6 n/a
3 TRCN0000046655 CCCATATATCAACACTCGTAT pLKO.1 775 3UTR 100% 4.950 6.930 N DPP6 n/a
4 TRCN0000428050 TAGCAGTGCGTGTTCATATAT pLKO_005 3216 3UTR 100% 15.000 10.500 N DPP6 n/a
5 TRCN0000046653 CCCTACACGTTATTGGCTTAA pLKO.1 1214 3UTR 100% 10.800 7.560 N DPP6 n/a
6 TRCN0000046656 GCAGAACTCATTACACAACTA pLKO.1 2555 3UTR 100% 4.950 3.465 N DPP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_157196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06117 pDONR223 100% 52.2% None (many diffs) n/a
2 TRCN0000475895 TGACCAGGCTTGGCCAATGACTTC pLX_317 14.3% 52.2% V5 (many diffs) n/a
3 ccsbBroadEn_14618 pDONR223 50.6% 52.1% None (many diffs) n/a
Download CSV