Transcript: Human NR_157804.1

Homo sapiens putative POM121-like protein 1-like pseudogene (LOC101929599), non-coding RNA.

Source:
NCBI, updated 2018-08-03
Taxon:
Homo sapiens (human)
Gene:
LOC101929599 (101929599)
Length:
4995
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_157804.1
NBCI Gene record:
LOC101929599 (101929599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_157804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166600 CCAGAGGTCAGAAGTGAGATA pLKO.1 2039 3UTR 100% 4.950 2.475 Y LOC729915 n/a
2 TRCN0000166305 CCCAGAGCTCAGAAATCAGAT pLKO.1 1102 3UTR 100% 4.950 2.475 Y LOC729915 n/a
3 TRCN0000164983 GCTGACCCTCAGTTACTCAAA pLKO.1 1253 3UTR 100% 4.950 2.475 Y LOC729915 n/a
4 TRCN0000163867 CCTCAGTTACTCAAAGACAGT pLKO.1 1259 3UTR 100% 2.640 1.320 Y LOC729915 n/a
5 TRCN0000165098 CCTCAGTTCCTCAAACACAGT pLKO.1 2195 3UTR 100% 2.640 1.320 Y LOC729915 n/a
6 TRCN0000162854 CTACTCAATGCAGTGGATGAA pLKO.1 1974 3UTR 100% 4.950 2.475 Y LOC729915 n/a
7 TRCN0000166659 CGAGCACCAAACGAAATGCTA pLKO.1 1156 3UTR 100% 3.000 1.500 Y LOC729915 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_157804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10587 pDONR223 100% 23.7% None (many diffs) n/a
2 ccsbBroad304_10587 pLX_304 0% 23.7% V5 (many diffs) n/a
3 TRCN0000472538 GCTGGAAACCAGACTTGAAGCAAA pLX_317 39.6% 23.7% V5 (many diffs) n/a
Download CSV