Transcript: Human NR_157838.1

Homo sapiens integrator complex subunit 4 pseudogene (LOC101929322), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
LOC101929322 (101929322)
Length:
8046
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_157838.1
NBCI Gene record:
LOC101929322 (101929322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_157838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134641 GTCCCAATTCCTTCTTCTAAT pLKO.1 582 3UTR 100% 13.200 6.600 Y INTS4P1 n/a
2 TRCN0000016523 GCAAGTCAGTTCTCATTTCTT pLKO.1 710 3UTR 100% 5.625 2.813 Y LOC401361 n/a
3 TRCN0000129887 GCAAGTCAGTTCTCATTTCTT pLKO.1 710 3UTR 100% 5.625 2.813 Y INTS4 n/a
4 TRCN0000128560 GCCTGTAAATTACTCTCTGAT pLKO.1 489 3UTR 100% 4.950 2.475 Y INTS4 n/a
5 TRCN0000016525 GCTCCCAAGGAAGAAGTAGAT pLKO.1 852 3UTR 100% 4.950 2.475 Y LOC401361 n/a
6 TRCN0000128108 CGCTTAGTTGATGATGCGTTT pLKO.1 612 3UTR 100% 4.050 2.025 Y INTS4 n/a
7 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1083 3UTR 100% 13.200 6.600 Y IQCC n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1181 3UTR 100% 10.800 5.400 Y SMIM11A n/a
9 TRCN0000082354 CGGAGGCGATGGGAGAGAATA pLKO.1 280 3UTR 100% 4.400 2.200 Y LOC388259 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_157838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.