Transcript: Human NR_159737.1

Homo sapiens nuclear RNA export factor 5 (NXF5), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-11-14
Taxon:
Homo sapiens (human)
Gene:
NXF5 (55998)
Length:
1848
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159737.1
NBCI Gene record:
NXF5 (55998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435132 CAGACCGTGAACACCTGCTTC pLKO_005 1204 3UTR 100% 1.350 1.890 N NXF5 n/a
2 TRCN0000417823 CTCAGTGCATTGCCTGAAACT pLKO_005 1144 3UTR 100% 4.950 3.465 N NXF5 n/a
3 TRCN0000425703 CTGAAACTCAGCATGACTTCA pLKO_005 1157 3UTR 100% 4.950 3.465 N NXF5 n/a
4 TRCN0000060231 GAAATGGTTCAAGGTCACAAT pLKO.1 393 3UTR 100% 4.950 3.465 N NXF5 n/a
5 TRCN0000060228 GCAGAGCAACTTGTGCAAGTA pLKO.1 1029 3UTR 100% 4.950 3.465 N NXF5 n/a
6 TRCN0000416086 TGCAGAGGAAGCTGCTAAAGC pLKO_005 1094 3UTR 100% 4.950 3.465 N NXF5 n/a
7 TRCN0000060229 CCTGAAGATCACTGAAAGAAA pLKO.1 621 3UTR 100% 5.625 3.375 N NXF5 n/a
8 TRCN0000414647 GTCTGCCTATGTAAGTGCCAT pLKO_005 855 3UTR 100% 2.640 1.584 N NXF5 n/a
9 TRCN0000441652 ACTTGATGGGCCGTGACATTG pLKO_005 563 3UTR 100% 10.800 5.400 Y NXF2 n/a
10 TRCN0000416766 ATAATCCTGAATCGAAGAAAC pLKO_005 586 3UTR 100% 10.800 5.400 Y NXF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03695 pDONR223 100% 66.4% None (many diffs) n/a
2 TRCN0000469382 TTTTGAACAGGCTCTTCGGCTTTG pLX_317 23.6% 66.4% V5 (many diffs) n/a
3 ccsbBroadEn_03693 pDONR223 100% 53.2% None (many diffs) n/a
4 ccsbBroad304_03693 pLX_304 0% 53.2% V5 (many diffs) n/a
5 TRCN0000476734 TTTCGGCATCGACTTGCTGAAGGC pLX_317 40.6% 53.2% V5 (many diffs) n/a
Download CSV