Transcript: Human NR_159803.1

Homo sapiens retinitis pigmentosa GTPase regulator (RPGR), transcript variant K, non-coding RNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
RPGR (6103)
Length:
3269
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159803.1
NBCI Gene record:
RPGR (6103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047476 GCTACGACTATCGAAGCATTT pLKO.1 2079 3UTR 100% 10.800 15.120 N RPGR n/a
2 TRCN0000047473 CGGGCCATTTGTGAGTACAAT pLKO.1 2474 3UTR 100% 5.625 7.875 N RPGR n/a
3 TRCN0000350048 TGGATCTCTTGTGGATATTAC pLKO_005 722 3UTR 100% 13.200 10.560 N Rpgr n/a
4 TRCN0000047474 CCCGGTAAATTCTGGTTTAAA pLKO.1 221 3UTR 100% 15.000 10.500 N RPGR n/a
5 TRCN0000423400 TCCTACTTTGTGCTCTAATTT pLKO_005 1219 3UTR 100% 15.000 10.500 N RPGR n/a
6 TRCN0000047477 CCTGGATCTCTTGTGGATATT pLKO.1 720 3UTR 100% 13.200 9.240 N RPGR n/a
7 TRCN0000047475 CCTCCAATAGAAGGGACTCTT pLKO.1 1487 3UTR 100% 4.950 3.465 N RPGR n/a
8 TRCN0000423917 AGCTGTCTGCTGGATCTAATA pLKO_005 573 3UTR 100% 13.200 7.920 N RPGR n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1687 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1687 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11102 pDONR223 100% 43.8% None (many diffs) n/a
2 ccsbBroad304_11102 pLX_304 0% 43.8% V5 (many diffs) n/a
3 TRCN0000480493 TTCGACCCCTTGAACGGTGCTACT pLX_317 24.6% 43.8% V5 (many diffs) n/a
Download CSV