Transcript: Human NR_159880.1

Homo sapiens baculoviral IAP repeat containing 8 (BIRC8), non-coding RNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
BIRC8 (112401)
Length:
1834
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159880.1
NBCI Gene record:
BIRC8 (112401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034068 GACAGACATATCGCTGTTGTT pLKO.1 1640 3UTR 100% 4.950 6.930 N BIRC8 n/a
2 TRCN0000034067 GAGGATAAAGTACAGTGCTTT pLKO.1 1160 3UTR 100% 4.950 6.930 N BIRC8 n/a
3 TRCN0000034065 CCTAATCCTATGCTACAAGAA pLKO.1 1391 3UTR 100% 4.950 3.960 N BIRC8 n/a
4 TRCN0000436484 GGATGTACTCCGTTAACAAAG pLKO_005 1101 3UTR 100% 10.800 7.560 N BIRC8 n/a
5 TRCN0000431100 CAAACATCTGGGAGCAACTAT pLKO_005 1469 3UTR 100% 5.625 3.938 N BIRC8 n/a
6 TRCN0000034066 GCTATACGAATGGGATTTGAT pLKO.1 1412 3UTR 100% 5.625 3.938 N BIRC8 n/a
7 TRCN0000034064 GCTCAGAAAGACACTACAGAA pLKO.1 1526 3UTR 100% 4.950 3.465 N BIRC8 n/a
8 TRCN0000431652 ACATTCATTTAACCCGTTCAC pLKO_005 1299 3UTR 100% 4.050 2.835 N BIRC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09370 pDONR223 100% 55.1% None (many diffs) n/a
2 ccsbBroad304_09370 pLX_304 0% 55.1% V5 (many diffs) n/a
3 TRCN0000474853 AGCACGGCACACCGTCACAGTTAT pLX_317 49.7% 55.1% V5 (many diffs) n/a
4 ccsbBroadEn_09369 pDONR223 100% 38.4% None (many diffs) n/a
5 ccsbBroad304_09369 pLX_304 0% 38.4% V5 (many diffs) n/a
6 TRCN0000469926 GTCTCATAATGATACAGGACTTGT pLX_317 54.1% 38.4% V5 (many diffs) n/a
Download CSV