Transcript: Human NR_160934.1

Homo sapiens arginase 1 (ARG1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ARG1 (383)
Length:
1374
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160934.1
NBCI Gene record:
ARG1 (383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050823 CCTGTATATCTGCCAAGGATA pLKO.1 484 3UTR 100% 4.950 3.960 N ARG1 n/a
2 TRCN0000417399 CTCATAGTTAATGGCATAATT pLKO_005 977 3UTR 100% 15.000 10.500 N ARG1 n/a
3 TRCN0000413060 GCATAGAGTTATCCTTCTAAA pLKO_005 1020 3UTR 100% 13.200 9.240 N ARG1 n/a
4 TRCN0000050827 GCTACTCTCAGGATTAGATAT pLKO.1 788 3UTR 100% 13.200 9.240 N ARG1 n/a
5 TRCN0000101799 TCTCTACATCACAGAAGAAAT pLKO.1 755 3UTR 100% 13.200 9.240 N Arg1 n/a
6 TRCN0000050825 CAAGCCTATTGACTACCTTAA pLKO.1 920 3UTR 100% 10.800 7.560 N ARG1 n/a
7 TRCN0000427723 GAGACCACAGTTTGGCAATTG pLKO_005 280 3UTR 100% 10.800 7.560 N ARG1 n/a
8 TRCN0000050826 GCATGGACAACCTGTATCTTT pLKO.1 404 3UTR 100% 5.625 3.938 N ARG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00098 pDONR223 100% 61.7% None 1_57del;112_113ins73;951_1374del n/a
2 ccsbBroad304_00098 pLX_304 0% 61.7% V5 1_57del;112_113ins73;951_1374del n/a
3 TRCN0000465901 ACACGTCCTAACCAGTCCAGGGGA pLX_317 29.6% 61.7% V5 1_57del;112_113ins73;951_1374del n/a
Download CSV