Transcript: Human NR_161268.1

Homo sapiens chromosome 7 open reading frame 69 (C7orf69), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-04-01
Taxon:
Homo sapiens (human)
Gene:
C7orf69 (80099)
Length:
664
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161268.1
NBCI Gene record:
C7orf69 (80099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137502 CCAAGTCATGTGGAAATGTCT pLKO.1 137 3UTR 100% 3.000 4.200 N C7orf69 n/a
2 TRCN0000138369 CATCAGGAAAGGAGAACACAG pLKO.1 277 3UTR 100% 4.050 2.835 N C7orf69 n/a
3 TRCN0000134233 GAAATAACTGCTGGTTTCACA pLKO.1 389 3UTR 100% 3.000 2.100 N C7orf69 n/a
4 TRCN0000133730 CAAACTATCAAATGCAGAGCA pLKO.1 205 3UTR 100% 2.640 1.848 N C7orf69 n/a
5 TRCN0000137834 GAGAACACAGATGGAGACAGA pLKO.1 288 3UTR 100% 2.640 1.848 N C7orf69 n/a
6 TRCN0000137600 CTACAGAACACCCAGACTCAT pLKO.1 494 3UTR 100% 4.950 2.970 N C7orf69 n/a
7 TRCN0000137924 GCATCAGGAAAGGAGAACACA pLKO.1 276 3UTR 100% 3.000 1.800 N C7orf69 n/a
8 TRCN0000136835 CACCATGTAAGAAGTGCCTTT pLKO.1 89 3UTR 100% 4.050 2.025 Y C7orf69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04173 pDONR223 100% 55.1% None 1_45del;412_664del n/a
2 ccsbBroad304_04173 pLX_304 0% 55.1% V5 1_45del;412_664del n/a
3 TRCN0000477453 ATAAATCATAAGGACGATTGCCCG pLX_317 75.8% 55.1% V5 1_45del;412_664del n/a
Download CSV