Transcript: Human NR_161370.1

Homo sapiens chromosome 15 open reading frame 32 (C15orf32), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2019-04-04
Taxon:
Homo sapiens (human)
Gene:
C15orf32 (145858)
Length:
1726
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161370.1
NBCI Gene record:
C15orf32 (145858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172717 GCAACCTTCCTTTGGAGGTTA pLKO.1 1026 3UTR 100% 0.495 0.693 N C15orf32 n/a
2 TRCN0000168379 GCAGATATTCTGTGTAGCTGA pLKO.1 865 3UTR 100% 2.640 2.112 N C15orf32 n/a
3 TRCN0000263511 AGCCCTGAAGGCCACTTAATT pLKO_005 797 3UTR 100% 15.000 10.500 N C15orf32 n/a
4 TRCN0000282651 AGATTGGAGCTGTTCGTAATT pLKO_005 1292 3UTR 100% 13.200 9.240 N C15orf32 n/a
5 TRCN0000263512 CTCGACCCAAAGCAGATATTC pLKO_005 854 3UTR 100% 13.200 9.240 N C15orf32 n/a
6 TRCN0000281590 GCACCAGAAGAGGCATCTTAT pLKO_005 928 3UTR 100% 13.200 9.240 N C15orf32 n/a
7 TRCN0000263510 TGCTGAAGCCAACATTGTTAA pLKO_005 759 3UTR 100% 13.200 9.240 N C15orf32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13230 pDONR223 100% 28.6% None 1_472del;968_1726del n/a
2 ccsbBroad304_13230 pLX_304 0% 28.6% V5 1_472del;968_1726del n/a
3 TRCN0000468377 CAAACTAGACGCAGGGACGGTCCG pLX_317 82.2% 28.6% V5 1_472del;968_1726del n/a
Download CSV