Transcript: Human NR_163176.1

Homo sapiens IGF like family member 4 (IGFL4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-04-22
Taxon:
Homo sapiens (human)
Gene:
IGFL4 (444882)
Length:
2042
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163176.1
NBCI Gene record:
IGFL4 (444882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166595 CGGTGTCATCCTAGACTTGAA pLKO.1 1107 3UTR 100% 4.950 6.930 N IGFL4 n/a
2 TRCN0000163220 GTCAAGATCTGACCTCATCTA pLKO.1 1311 3UTR 100% 4.950 3.960 N IGFL4 n/a
3 TRCN0000163596 CAGATCTTAGACTGTGGCTAT pLKO.1 1025 3UTR 100% 4.050 3.240 N IGFL4 n/a
4 TRCN0000166823 CCAGACAGTTGTGAGGTTCAA pLKO.1 1209 3UTR 100% 4.950 3.465 N IGFL4 n/a
5 TRCN0000372512 GGCATGAAGCCAGATTGCAAG pLKO_005 1237 3UTR 100% 4.050 2.835 N IGFL4 n/a
6 TRCN0000372451 TGCCCAGGAATACCACCCAAA pLKO_005 1281 3UTR 100% 4.050 2.835 N IGFL4 n/a
7 TRCN0000165883 GAACCAGACAGTTGTGAGGTT pLKO.1 1206 3UTR 100% 2.640 1.848 N IGFL4 n/a
8 TRCN0000165496 GACAGTTGTGAGGTTCAAGGT pLKO.1 1212 3UTR 100% 2.640 1.848 N IGFL4 n/a
9 TRCN0000163255 GTTCAAACTCAGAAGGAGTCA pLKO.1 1004 3UTR 100% 2.640 1.848 N IGFL4 n/a
10 TRCN0000378734 TGGAGTCTTTGGGCTCTCAGA pLKO_005 1187 3UTR 100% 2.640 1.848 N IGFL4 n/a
11 TRCN0000164342 CAGAAGGAGTCACAGATCTTA pLKO.1 1013 3UTR 100% 5.625 3.375 N IGFL4 n/a
12 TRCN0000149587 CCTCTTCAAGGAGAACTACAA pLKO.1 1625 3UTR 100% 4.950 2.475 Y POT1-AS1 n/a
13 TRCN0000157513 GCCAAGTCAATCCTAAGCCAA pLKO.1 1857 3UTR 100% 2.640 1.320 Y LOC340211 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13802 pDONR223 100% 12.2% None (many diffs) n/a
2 ccsbBroad304_13802 pLX_304 0% 12.2% V5 (many diffs) n/a
3 TRCN0000470799 AAGCCATAAGTTAGAAACAAACCG pLX_317 52.2% 12.2% V5 (many diffs) n/a
Download CSV