Transcript: Human NR_163999.1

Homo sapiens ankyrin repeat domain 30B like (ANKRD30BL), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
ANKRD30BL (554226)
Length:
1612
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_163999.1
NBCI Gene record:
ANKRD30BL (554226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_163999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183329 GCAAATGCAGTTGATAAGTTT pLKO.1 721 3UTR 100% 5.625 3.375 N ANKRD30BL n/a
2 TRCN0000168110 CTGAAAGCTTGGTGGAAAGAA pLKO.1 1038 3UTR 100% 5.625 2.813 Y ANKRD30BP2 n/a
3 TRCN0000168692 GAAGGAACATCTGAAGGAACA pLKO.1 974 3UTR 100% 4.050 2.025 Y ANKRD30BP2 n/a
4 TRCN0000168157 CAGAAGGAACATCTGAAGGAA pLKO.1 972 3UTR 100% 3.000 1.500 Y ANKRD30BP2 n/a
5 TRCN0000172355 CCAGAAGGAACATCTGAAGGA pLKO.1 971 3UTR 100% 2.640 1.320 Y ANKRD30BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_163999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10303 pDONR223 100% 12.4% None (many diffs) n/a
2 ccsbBroad304_10303 pLX_304 0% 12.4% V5 (many diffs) n/a
3 TRCN0000476207 CTCACACCATTTCATCTACCCCAA pLX_317 100% 12.4% V5 (many diffs) n/a
Download CSV