Transcript: Mouse NM_027570.3

Mus musculus lactate dehydrogenase D (Ldhd), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ldhd (52815)
Length:
2235
CDS:
13..1467

Additional Resources:

NCBI RefSeq record:
NM_027570.3
NBCI Gene record:
Ldhd (52815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027570.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042068 GCTCGCATTGAGTTCCTAGAT pLKO.1 832 CDS 100% 4.950 6.930 N Ldhd n/a
2 TRCN0000042070 GTCACCCGTAAAGCTCTCAAT pLKO.1 424 CDS 100% 4.950 6.930 N Ldhd n/a
3 TRCN0000042069 CTGTGCTACAATCAAGGTGTT pLKO.1 262 CDS 100% 4.050 5.670 N Ldhd n/a
4 TRCN0000042071 AGAGGCAATCACTCAGGATAA pLKO.1 969 CDS 100% 10.800 7.560 N Ldhd n/a
5 TRCN0000042072 GTAGAGACCAAGGAGGAGATT pLKO.1 1150 CDS 100% 4.950 3.465 N Ldhd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027570.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05175 pDONR223 100% 78.4% 81.4% None (many diffs) n/a
2 ccsbBroad304_05175 pLX_304 0% 78.4% 81.4% V5 (many diffs) n/a
3 TRCN0000467686 GGTGCGCCTATGCCGCGCTGGTGC pLX_317 30.3% 78.4% 81.4% V5 (many diffs) n/a
Download CSV