Transcript: Human NM_001004440.1

Homo sapiens TAFA chemokine like family member 3 (TAFA3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-14
Taxon:
Homo sapiens (human)
Gene:
TAFA3 (284467)
Length:
1144
CDS:
70..579

Additional Resources:

NCBI RefSeq record:
NM_001004440.1
NBCI Gene record:
TAFA3 (284467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161347 GATCTGCAATCACATACCTAA pLKO.1 708 3UTR 100% 4.950 6.930 N TAFA3 n/a
2 TRCN0000165231 GACGGTGAAATGCTCCTGTTT pLKO.1 264 CDS 100% 4.950 3.960 N TAFA3 n/a
3 TRCN0000165683 CAGCAGTGGACACAAAGTCAA pLKO.1 497 CDS 100% 4.950 3.465 N TAFA3 n/a
4 TRCN0000162259 CATAGAAACAAGAGGTCACAT pLKO.1 945 3UTR 100% 4.950 3.465 N TAFA3 n/a
5 TRCN0000164325 CCGTGAACTGAAGAATGGTAT pLKO.1 581 3UTR 100% 4.950 3.465 N TAFA3 n/a
6 TRCN0000166655 CAAGGTCACACGATAGCTCTT pLKO.1 524 CDS 100% 4.050 2.835 N TAFA3 n/a
7 TRCN0000165968 GCCCTTAAGGAATGTCCAGTT pLKO.1 777 3UTR 100% 4.050 2.835 N TAFA3 n/a
8 TRCN0000165072 GCCGTGAACTGAAGAATGGTA pLKO.1 580 CDS 100% 3.000 2.100 N TAFA3 n/a
9 TRCN0000164886 GCTCAGCAGATATGGATGGAT pLKO.1 690 3UTR 100% 3.000 2.100 N TAFA3 n/a
10 TRCN0000165073 GCCTCATGTCAAATGCAGCAT pLKO.1 640 3UTR 100% 2.640 1.848 N TAFA3 n/a
11 TRCN0000164677 CAACACACAATTCCTGCCCTT pLKO.1 762 3UTR 100% 2.160 1.512 N TAFA3 n/a
12 TRCN0000166630 CCACAGTTCTTCAGATACCCT pLKO.1 912 3UTR 100% 0.750 0.525 N TAFA3 n/a
13 TRCN0000162171 CAGTTGAATTGGAGAGTTGAT pLKO.1 793 3UTR 100% 4.950 2.970 N TAFA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05381 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05381 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476817 GGTAGAAAGCCTACACAACTAGCG pLX_317 65.8% 100% 100% V5 n/a
Download CSV