Transcript: Mouse NM_018768.2

Mus musculus syntaxin 8 (Stx8), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stx8 (55943)
Length:
4123
CDS:
19..729

Additional Resources:

NCBI RefSeq record:
NM_018768.2
NBCI Gene record:
Stx8 (55943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100871 CGTGTCAGATAGCCCAAGAAA pLKO.1 56 CDS 100% 5.625 7.875 N Stx8 n/a
2 TRCN0000100872 GCTCCTGGCATCGTTTAAGAA pLKO.1 294 CDS 100% 5.625 7.875 N Stx8 n/a
3 TRCN0000287274 GCTCCTGGCATCGTTTAAGAA pLKO_005 294 CDS 100% 5.625 7.875 N Stx8 n/a
4 TRCN0000294842 ATGCCCTTTCCTCTATCATAA pLKO_005 485 CDS 100% 13.200 9.240 N Stx8 n/a
5 TRCN0000307419 CCCAACAGTGCTGGCTATTTC pLKO_005 1227 3UTR 100% 13.200 9.240 N Stx8 n/a
6 TRCN0000100873 GAGAAGATTCAAGAACGAAAT pLKO.1 82 CDS 100% 10.800 7.560 N Stx8 n/a
7 TRCN0000287339 GAGAAGATTCAAGAACGAAAT pLKO_005 82 CDS 100% 10.800 7.560 N Stx8 n/a
8 TRCN0000100870 CCCTGTCTTCTGTCAGTGATT pLKO.1 917 3UTR 100% 4.950 3.465 N Stx8 n/a
9 TRCN0000100874 GTCAACTTCCTGTGGGATGAT pLKO.1 648 CDS 100% 4.950 3.465 N Stx8 n/a
10 TRCN0000287275 GTCAACTTCCTGTGGGATGAT pLKO_005 648 CDS 100% 4.950 3.465 N Stx8 n/a
11 TRCN0000059829 CCTCTATCATAAGTCGCCAAA pLKO.1 494 CDS 100% 4.050 2.835 N STX8 n/a
12 TRCN0000299706 CCTCTATCATAAGTCGCCAAA pLKO_005 494 CDS 100% 4.050 2.835 N STX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07425 pDONR223 100% 88.5% 92.7% None (many diffs) n/a
2 ccsbBroad304_07425 pLX_304 0% 88.5% 92.7% V5 (many diffs) n/a
3 TRCN0000469685 AATATTCTTTATACGACCAGCCAT pLX_317 64.6% 88.5% 92.7% V5 (many diffs) n/a
Download CSV