Transcript: Mouse NM_001039522.1

Mus musculus Leo1, Paf1/RNA polymerase II complex component (Leo1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Leo1 (235497)
Length:
2192
CDS:
55..2058

Additional Resources:

NCBI RefSeq record:
NM_001039522.1
NBCI Gene record:
Leo1 (235497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243543 GACGATGACAAAGCGAATAAA pLKO_005 1987 CDS 100% 15.000 21.000 N Leo1 n/a
2 TRCN0000257169 CAGCGCACAGAGATGATTAAG pLKO_005 1648 CDS 100% 13.200 18.480 N Leo1 n/a
3 TRCN0000257213 CGCTCTGACCACGAGGATAAT pLKO_005 331 CDS 100% 13.200 18.480 N Leo1 n/a
4 TRCN0000243542 GACTTGGGCAATGACTTATAT pLKO_005 1159 CDS 100% 15.000 10.500 N Leo1 n/a
5 TRCN0000190665 GCATCCAGTAGCTTCTGATAA pLKO.1 702 CDS 100% 13.200 9.240 N Leo1 n/a
6 TRCN0000243544 TCGGAGGTGCAGATGACATAT pLKO_005 1001 CDS 100% 13.200 9.240 N Leo1 n/a
7 TRCN0000189893 GAAAGGCCACAAGTCTCAGAT pLKO.1 802 CDS 100% 4.950 3.465 N Leo1 n/a
8 TRCN0000008736 CCTCAGTATTATGAAGATGAA pLKO.1 1228 CDS 100% 4.950 2.475 Y LEO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04770 pDONR223 100% 86.8% 93.5% None (many diffs) n/a
2 ccsbBroad304_04770 pLX_304 0% 86.8% 93.5% V5 (many diffs) n/a
3 TRCN0000476344 TTCCGTGATGCGAGACGAATTCGC pLX_317 18.8% 86.8% 93.5% V5 (many diffs) n/a
Download CSV