Transcript: Human NM_194448.2

Homo sapiens C-type lectin domain family 4 member A (CLEC4A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Homo sapiens (human)
Gene:
CLEC4A (50856)
Length:
1068
CDS:
248..745

Additional Resources:

NCBI RefSeq record:
NM_194448.2
NBCI Gene record:
CLEC4A (50856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055862 GCGCTGCGTTGTGCTAAATTT pLKO.1 634 CDS 100% 15.000 21.000 N CLEC4A n/a
2 TRCN0000430409 TTAGGTGGTCTGTCAACTATT pLKO_005 846 3UTR 100% 13.200 18.480 N CLEC4A n/a
3 TRCN0000055860 GCAAGAAGAATCTGCTTATTT pLKO.1 502 CDS 100% 15.000 10.500 N CLEC4A n/a
4 TRCN0000055858 GCCCAAAGAATTGGAAGTCAT pLKO.1 348 CDS 100% 4.950 3.465 N CLEC4A n/a
5 TRCN0000055861 GCAGGATTTCATCTTCCAGAA pLKO.1 478 CDS 100% 4.050 2.835 N CLEC4A n/a
6 TRCN0000422898 TGGGTTGATCAGACACCATAT pLKO_005 563 CDS 100% 10.800 6.480 N Clec4a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08189 pDONR223 100% 69.6% 69.6% None 80_81ins216 n/a
2 ccsbBroad304_08189 pLX_304 0% 69.6% 69.6% V5 80_81ins216 n/a
3 TRCN0000469785 CCAATGTTCCCAATACTCCGACTT pLX_317 46.4% 69.6% 69.6% V5 80_81ins216 n/a
4 ccsbBroadEn_03158 pDONR223 100% 69.6% 69.6% None 80_81ins216 n/a
5 ccsbBroad304_03158 pLX_304 0% 69.6% 69.6% V5 80_81ins216 n/a
6 TRCN0000476606 AAATCCTAGGCTATCCATTGGTCA pLX_317 46.7% 69.6% 69.6% V5 80_81ins216 n/a
Download CSV