Transcript: Mouse NM_001083901.1

Mus musculus major facilitator superfamily domain containing 14B (Mfsd14b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mfsd14b (66631)
Length:
3375
CDS:
269..1792

Additional Resources:

NCBI RefSeq record:
NM_001083901.1
NBCI Gene record:
Mfsd14b (66631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101926 CCGGAATCTCTATCGGAGAAA pLKO.1 926 CDS 100% 4.950 6.930 N Mfsd14b n/a
2 TRCN0000334566 CCGGAATCTCTATCGGAGAAA pLKO_005 926 CDS 100% 4.950 6.930 N Mfsd14b n/a
3 TRCN0000348327 CATTCCCTCTTAGTCTATAAA pLKO_005 2219 3UTR 100% 15.000 12.000 N Mfsd14b n/a
4 TRCN0000348326 GAGCTATAACCCAGTAGTAAT pLKO_005 1784 CDS 100% 13.200 10.560 N Mfsd14b n/a
5 TRCN0000101928 CGTCATTAAAGAAAGTTGGAA pLKO.1 1002 CDS 100% 3.000 2.400 N Mfsd14b n/a
6 TRCN0000101929 CTGCTTCCCTATCCCACTAAT pLKO.1 634 CDS 100% 13.200 9.240 N Mfsd14b n/a
7 TRCN0000334487 CTGCTTCCCTATCCCACTAAT pLKO_005 634 CDS 100% 13.200 9.240 N Mfsd14b n/a
8 TRCN0000151902 CAACACACATTCCTCATGAAT pLKO.1 500 CDS 100% 5.625 3.938 N MFSD14C n/a
9 TRCN0000101927 CAGCATTATATGGCTTCATAT pLKO.1 1455 CDS 100% 1.320 0.924 N Mfsd14b n/a
10 TRCN0000101925 GCTGCATAGTAAATGGACTAT pLKO.1 2931 3UTR 100% 0.495 0.347 N Mfsd14b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10264 pDONR223 100% 14.3% 12.9% None (many diffs) n/a
2 ccsbBroad304_10264 pLX_304 0% 14.3% 12.9% V5 (many diffs) n/a
3 TRCN0000470777 GTACTCACCACGTTGCAGTTCAGG pLX_317 100% 14.3% 12.9% V5 (many diffs) n/a
Download CSV