Transcript: Mouse NM_133966.2

Mus musculus TATA-box binding protein associated factor 5 like (Taf5l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Taf5l (102162)
Length:
2893
CDS:
125..1894

Additional Resources:

NCBI RefSeq record:
NM_133966.2
NBCI Gene record:
Taf5l (102162)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234360 ACGTACCCGCTGAGGATATAT pLKO_005 1370 CDS 100% 15.000 21.000 N TAF5L n/a
2 TRCN0000307478 ACGTACCCGCTGAGGATATAT pLKO_005 1370 CDS 100% 15.000 21.000 N Taf5l n/a
3 TRCN0000039284 GCGGTTAAAGTTGTGGGACTT pLKO.1 1594 CDS 100% 4.050 3.240 N Taf5l n/a
4 TRCN0000294927 GCACCGTGGAAAGCTTCTATA pLKO_005 465 CDS 100% 13.200 9.240 N Taf5l n/a
5 TRCN0000039285 CCAGGACATTCTGTCAAACTT pLKO.1 562 CDS 100% 5.625 3.938 N Taf5l n/a
6 TRCN0000287472 CCAGGACATTCTGTCAAACTT pLKO_005 562 CDS 100% 5.625 3.938 N Taf5l n/a
7 TRCN0000039286 GCATTCCTGGACAACAAGTAT pLKO.1 593 CDS 100% 5.625 3.938 N Taf5l n/a
8 TRCN0000287552 GCATTCCTGGACAACAAGTAT pLKO_005 593 CDS 100% 5.625 3.938 N Taf5l n/a
9 TRCN0000039287 CAGTCCAATCAGAATCTGGTT pLKO.1 264 CDS 100% 2.640 1.848 N Taf5l n/a
10 TRCN0000039288 GCCTGTACTTTGCCAGTGGAT pLKO.1 1311 CDS 100% 2.640 1.848 N Taf5l n/a
11 TRCN0000294963 ACTCCTGGCACTGGCTATAAT pLKO_005 2317 3UTR 100% 15.000 9.000 N Taf5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08053 pDONR223 100% 47.6% 50.9% None (many diffs) n/a
2 ccsbBroad304_08053 pLX_304 0% 47.6% 50.9% V5 (many diffs) n/a
3 TRCN0000465591 TCGGGACCCTACAGAATTAAACAT pLX_317 31.9% 47.6% 50.9% V5 (many diffs) n/a
Download CSV