Transcript: Mouse NM_026362.2

Mus musculus plasminogen receptor, C-terminal lysine transmembrane protein (Plgrkt), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Plgrkt (67759)
Length:
843
CDS:
193..636

Additional Resources:

NCBI RefSeq record:
NM_026362.2
NBCI Gene record:
Plgrkt (67759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305338 GACAAATGAAGTCACAGTTAT pLKO_005 628 CDS 100% 13.200 9.240 N Plgrkt n/a
2 TRCN0000124965 CCAGCCTTTCTCGTTCCTATA pLKO.1 424 CDS 100% 10.800 7.560 N Plgrkt n/a
3 TRCN0000309563 CCAGCCTTTCTCGTTCCTATA pLKO_005 424 CDS 100% 10.800 7.560 N Plgrkt n/a
4 TRCN0000305399 TCATCTTCACCTACCAGTATG pLKO_005 458 CDS 100% 10.800 7.560 N Plgrkt n/a
5 TRCN0000124966 CACCTTTGAAAGCCTTGAGAA pLKO.1 576 CDS 100% 4.950 3.465 N Plgrkt n/a
6 TRCN0000124967 CTTTAGCAACTGGAGCACTAA pLKO.1 392 CDS 100% 4.950 3.465 N Plgrkt n/a
7 TRCN0000309561 CTTTAGCAACTGGAGCACTAA pLKO_005 392 CDS 100% 4.950 3.465 N Plgrkt n/a
8 TRCN0000124968 GAGGACATATTGGAAACAGAA pLKO.1 523 CDS 100% 4.950 3.465 N Plgrkt n/a
9 TRCN0000124964 GCACAAAGTTGTTGGCTTGAA pLKO.1 676 3UTR 100% 4.950 3.465 N Plgrkt n/a
10 TRCN0000309562 GCACAAAGTTGTTGGCTTGAA pLKO_005 676 3UTR 100% 4.950 3.465 N Plgrkt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08598 pDONR223 100% 85.2% 82.3% None (many diffs) n/a
2 ccsbBroad304_08598 pLX_304 0% 85.2% 82.3% V5 (many diffs) n/a
3 TRCN0000492048 AGCTAATAAACATTTGAACCATAA pLX_317 34.4% 85.2% 82.3% V5 (many diffs) n/a
Download CSV