Transcript: Mouse NM_021429.3

Mus musculus HCLS1 binding protein 3 (Hs1bp3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Hs1bp3 (58240)
Length:
2958
CDS:
34..1221

Additional Resources:

NCBI RefSeq record:
NM_021429.3
NBCI Gene record:
Hs1bp3 (58240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258000 ATGGACATCTTGCAGTATATC pLKO_005 1156 CDS 100% 13.200 10.560 N Hs1bp3 n/a
2 TRCN0000250202 TGAACCCTAGTCCCTTTATAT pLKO_005 2586 3UTR 100% 15.000 10.500 N Hs1bp3 n/a
3 TRCN0000250204 GTCCAGTTCTTGGTCTCTAAA pLKO_005 220 CDS 100% 13.200 9.240 N Hs1bp3 n/a
4 TRCN0000250203 CAGAAGCTGTACAGTTGTTAC pLKO_005 268 CDS 100% 10.800 7.560 N Hs1bp3 n/a
5 TRCN0000250201 TGCCTAGGAAGGTCCTGTTTG pLKO_005 311 CDS 100% 10.800 7.560 N Hs1bp3 n/a
6 TRCN0000137245 GTTCAGAGTTGAAGAGGACTT pLKO.1 960 CDS 100% 4.050 2.835 N HS1BP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12467 pDONR223 100% 43.8% 42.9% None (many diffs) n/a
2 ccsbBroad304_12467 pLX_304 0% 43.8% 42.9% V5 (many diffs) n/a
3 TRCN0000474420 TTGCTGAGTACCGGGTCAGTGAAT pLX_317 82.2% 43.8% 42.9% V5 (many diffs) n/a
Download CSV