Transcript: Mouse NM_001114174.1

Mus musculus family with sequence similarity 189, member A2 (Fam189a2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam189a2 (381217)
Length:
2565
CDS:
83..1873

Additional Resources:

NCBI RefSeq record:
NM_001114174.1
NBCI Gene record:
Fam189a2 (381217)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239145 CATCTGGATCAACTCCTATTC pLKO_005 1257 CDS 100% 10.800 8.640 N Fam189a2 n/a
2 TRCN0000239147 AGCCAGTTTGCACGCAGATAA pLKO_005 1194 CDS 100% 13.200 9.240 N Fam189a2 n/a
3 TRCN0000239144 TGAACTTGTAGAGAACATAAA pLKO_005 1579 CDS 100% 13.200 9.240 N Fam189a2 n/a
4 TRCN0000239146 GCAGGAGACATGATGGTTAAC pLKO_005 2307 3UTR 100% 10.800 7.560 N Fam189a2 n/a
5 TRCN0000239148 TGCGCTACCTCCAGATCTTTG pLKO_005 837 CDS 100% 10.800 7.560 N Fam189a2 n/a
6 TRCN0000130756 GAAGTGTTCTGTCCTCTGGAT pLKO.1 1073 CDS 100% 2.640 1.848 N FAM189A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02158 pDONR223 100% 63.4% 65.9% None (many diffs) n/a
2 ccsbBroad304_02158 pLX_304 0% 63.4% 65.9% V5 (many diffs) n/a
3 TRCN0000478928 TACTGTGACCAATTTTTATACCCA pLX_317 31.9% 63.4% 65.9% V5 (many diffs) n/a
Download CSV