Transcript: Mouse NM_001130186.1

Mus musculus jade family PHD finger 1 (Jade1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Jade1 (269424)
Length:
5524
CDS:
151..2655

Additional Resources:

NCBI RefSeq record:
NM_001130186.1
NBCI Gene record:
Jade1 (269424)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104008 CGTCTCCTATCATCAGCACAA pLKO.1 2071 CDS 100% 4.050 5.670 N Jade1 n/a
2 TRCN0000309015 CGTCTCCTATCATCAGCACAA pLKO_005 2071 CDS 100% 4.050 5.670 N Jade1 n/a
3 TRCN0000104009 GCGAGGCATCAGAGAAGAAAT pLKO.1 2567 CDS 100% 13.200 10.560 N Jade1 n/a
4 TRCN0000308947 GCGAGGCATCAGAGAAGAAAT pLKO_005 2567 CDS 100% 13.200 10.560 N Jade1 n/a
5 TRCN0000104006 CCCTAGTCAAAGTGCCTATAA pLKO.1 2324 CDS 100% 13.200 9.240 N Jade1 n/a
6 TRCN0000309013 CCCTAGTCAAAGTGCCTATAA pLKO_005 2324 CDS 100% 13.200 9.240 N Jade1 n/a
7 TRCN0000104007 CGATGCTATGACAATATGAAT pLKO.1 694 CDS 100% 5.625 3.938 N Jade1 n/a
8 TRCN0000309014 CGATGCTATGACAATATGAAT pLKO_005 694 CDS 100% 5.625 3.938 N Jade1 n/a
9 TRCN0000104005 GCAAGCAAATACCCATTGTTT pLKO.1 2721 3UTR 100% 5.625 3.938 N Jade1 n/a
10 TRCN0000308946 GCAAGCAAATACCCATTGTTT pLKO_005 2721 3UTR 100% 5.625 3.938 N Jade1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04153 pDONR223 100% 55.3% 58.3% None (many diffs) n/a
2 ccsbBroad304_04153 pLX_304 0% 55.3% 58.3% V5 (many diffs) n/a
3 TRCN0000473040 AGTAGGCCGCTGGACCCCAATTAC pLX_317 32.3% 55.3% 58.3% V5 (many diffs) n/a
Download CSV