Transcript: Mouse NM_145393.4

Mus musculus YTH domain family 2 (Ythdf2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ythdf2 (213541)
Length:
4078
CDS:
331..2070

Additional Resources:

NCBI RefSeq record:
NM_145393.4
NBCI Gene record:
Ythdf2 (213541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176726 CTAGAGAACAACGAGAATAAA pLKO.1 1873 CDS 100% 15.000 21.000 N Ythdf2 n/a
2 TRCN0000254410 TACTGATTAAGTCAGGATTAA pLKO_005 2725 3UTR 100% 13.200 18.480 N YTHDF2 n/a
3 TRCN0000254336 CGGTCCATTAATAACTATAAC pLKO_005 1507 CDS 100% 13.200 9.240 N YTHDF2 n/a
4 TRCN0000197932 GCAAACTTGCAGTTTATGTAT pLKO.1 2187 3UTR 100% 5.625 3.938 N Ythdf2 n/a
5 TRCN0000198682 CCATGCCCTATCTAACTTCTT pLKO.1 575 CDS 100% 4.950 3.465 N Ythdf2 n/a
6 TRCN0000198671 CGTTTCGATGTCAGATGGATT pLKO.1 1810 CDS 100% 4.950 3.465 N Ythdf2 n/a
7 TRCN0000168709 GACTTCTCACACTATGAGAAA pLKO.1 1996 CDS 100% 0.495 0.347 N YTHDF2 n/a
8 TRCN0000254412 TCTGGATATAGTAGCAATTAT pLKO_005 769 CDS 100% 15.000 10.500 N YTHDF2 n/a
9 TRCN0000265510 GCTACTCTGAGGACGATATTC pLKO_005 1580 CDS 100% 13.200 9.240 N YTHDF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03308 pDONR223 100% 95.6% 99.6% None (many diffs) n/a
2 ccsbBroad304_03308 pLX_304 0% 95.6% 99.6% V5 (many diffs) n/a
3 TRCN0000468616 CAACCGAAACATCCGAAGCTCAAG pLX_317 18.5% 95.6% 99.6% V5 (many diffs) n/a
Download CSV