Transcript: Mouse NM_009602.4

Mus musculus cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) (Chrnb2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Chrnb2 (11444)
Length:
5405
CDS:
227..1732

Additional Resources:

NCBI RefSeq record:
NM_009602.4
NBCI Gene record:
Chrnb2 (11444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102860 CGGATCAGATTGGTAGATATA pLKO.1 4115 3UTR 100% 13.200 18.480 N Chrnb2 n/a
2 TRCN0000102864 TGTACGAAGTCTCCTTCTATT pLKO.1 603 CDS 100% 13.200 10.560 N Chrnb2 n/a
3 TRCN0000102861 CCCATGTACCTGCTTTGTCAA pLKO.1 1381 CDS 100% 4.950 3.465 N Chrnb2 n/a
4 TRCN0000102862 CGACTTCATCATTCGTCGCAA pLKO.1 904 CDS 100% 2.640 1.848 N Chrnb2 n/a
5 TRCN0000102863 CGCTATAACAAGCTGATCCGT pLKO.1 347 CDS 100% 0.750 0.525 N Chrnb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009602.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00309 pDONR223 100% 87.5% 94% None (many diffs) n/a
2 ccsbBroad304_00309 pLX_304 0% 87.5% 94% V5 (many diffs) n/a
3 TRCN0000475738 TTTCACCCTCTCATCTATCGTTTA pLX_317 1.8% 87.5% 94% V5 (many diffs) n/a
Download CSV