Transcript: Mouse NM_028343.4

Mus musculus transmembrane protein 135 (Tmem135), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem135 (72759)
Length:
3693
CDS:
200..1576

Additional Resources:

NCBI RefSeq record:
NM_028343.4
NBCI Gene record:
Tmem135 (72759)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279140 CCGAGAGCAATGAGCATAATC pLKO_005 848 CDS 100% 13.200 18.480 N Tmem135 n/a
2 TRCN0000174425 CTATTCCATCTCTACAGCAAT pLKO.1 1342 CDS 100% 4.950 6.930 N Tmem135 n/a
3 TRCN0000279202 CTATTCCATCTCTACAGCAAT pLKO_005 1342 CDS 100% 4.950 6.930 N Tmem135 n/a
4 TRCN0000193531 GCCATTCTTATTTCAGGGATA pLKO.1 2089 3UTR 100% 4.050 3.240 N Tmem135 n/a
5 TRCN0000279204 TAGAAAGGCGTTGCTTAATAA pLKO_005 1730 3UTR 100% 15.000 10.500 N Tmem135 n/a
6 TRCN0000217161 CAGGTGCAAAGATGGCTTAAA pLKO.1 706 CDS 100% 13.200 9.240 N Tmem135 n/a
7 TRCN0000174489 CAAGCAGATACGATCATCTAT pLKO.1 1325 CDS 100% 5.625 3.938 N Tmem135 n/a
8 TRCN0000279203 CAAGCAGATACGATCATCTAT pLKO_005 1325 CDS 100% 5.625 3.938 N Tmem135 n/a
9 TRCN0000174342 CCACAGAAACACTATTTAGAA pLKO.1 597 CDS 100% 5.625 3.938 N Tmem135 n/a
10 TRCN0000174958 GCTACCATGAAAGAGAACATA pLKO.1 3463 3UTR 100% 5.625 3.938 N Tmem135 n/a
11 TRCN0000193771 CCACTTGAGTTTGCTCAGAAT pLKO.1 2998 3UTR 100% 4.950 3.465 N Tmem135 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028343.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12511 pDONR223 100% 29.6% 27.8% None (many diffs) n/a
2 ccsbBroad304_12511 pLX_304 0% 29.6% 27.8% V5 (many diffs) n/a
3 TRCN0000478995 CAGACTGCAAATTCTAGCCCAAAG pLX_317 81.8% 29.6% 27.8% V5 (many diffs) n/a
Download CSV