Transcript: Mouse NR_027656.1

Mus musculus ornithine decarboxylase antizyme 1, pseudogene (Oaz1-ps), non-coding RNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Oaz1-ps (100041965)
Length:
963
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027656.1
NBCI Gene record:
Oaz1-ps (100041965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_027656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099625 GTCGTGATTGTGCAGAATAAA pLKO.1 800 3UTR 100% 15.000 7.500 Y Oaz1 n/a
2 TRCN0000315526 GTCGTGATTGTGCAGAATAAA pLKO_005 800 3UTR 100% 15.000 7.500 Y Oaz1 n/a
3 TRCN0000099627 TGCCCTTAATTGCTGTAGTAA pLKO.1 220 3UTR 100% 5.625 2.813 Y Oaz1 n/a
4 TRCN0000315525 TGCCCTTAATTGCTGTAGTAA pLKO_005 220 3UTR 100% 5.625 2.813 Y Oaz1 n/a
5 TRCN0000099629 AGCAGCGAGAGTTCTAGGGTT pLKO.1 200 3UTR 100% 2.640 1.320 Y Oaz1 n/a
6 TRCN0000309063 AGCAGCGAGAGTTCTAGGGTT pLKO_005 200 3UTR 100% 2.640 1.320 Y Oaz1 n/a
7 TRCN0000078495 CCACTGCTTCGCCAGAGAGAA pLKO.1 100 3UTR 100% 1.650 0.825 Y OAZ1 n/a
8 TRCN0000286446 CCACTGCTTCGCCAGAGAGAA pLKO_005 100 3UTR 100% 1.650 0.825 Y OAZ1 n/a
9 TRCN0000099628 GCCGCACCATGCCGCTTCTTA pLKO.1 156 3UTR 100% 0.000 0.000 Y Oaz1 n/a
10 TRCN0000315602 GCCGCACCATGCCGCTTCTTA pLKO_005 156 3UTR 100% 0.000 0.000 Y Oaz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027656.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11007 pDONR223 100% 19.1% None (many diffs) n/a
2 ccsbBroad304_11007 pLX_304 0% 19.1% V5 (many diffs) n/a
3 TRCN0000479612 CTCAAACGATGGACCAATGACCCC pLX_317 100% 19.1% V5 (many diffs) n/a
Download CSV